ID: 1142123040

View in Genome Browser
Species Human (GRCh38)
Location 16:88396619-88396641
Sequence CCTTCAGGAGGGTCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123040_1142123058 16 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123058 16:88396658-88396680 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123040_1142123052 5 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123052 16:88396647-88396669 CGGGCGGAGACCCTCCTGAAGGG No data
1142123040_1142123051 4 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG No data
1142123040_1142123054 12 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123054 16:88396654-88396676 AGACCCTCCTGAAGGGAGGCCGG No data
1142123040_1142123053 8 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123053 16:88396650-88396672 GCGGAGACCCTCCTGAAGGGAGG No data
1142123040_1142123055 13 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123040 Original CRISPR CCTTCAGGAGGGTCTCCTCC CGG (reversed) Intergenic