ID: 1142123051

View in Genome Browser
Species Human (GRCh38)
Location 16:88396646-88396668
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123046_1142123051 -7 Left 1142123046 16:88396630-88396652 CCCTCCTGAAGGGAGGCCGGGCG No data
Right 1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG No data
1142123040_1142123051 4 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG No data
1142123037_1142123051 20 Left 1142123037 16:88396603-88396625 CCCATCTGAAGGGAGGCCGGGAG No data
Right 1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG No data
1142123038_1142123051 19 Left 1142123038 16:88396604-88396626 CCATCTGAAGGGAGGCCGGGAGG No data
Right 1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG No data
1142123047_1142123051 -8 Left 1142123047 16:88396631-88396653 CCTCCTGAAGGGAGGCCGGGCGG No data
Right 1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123051 Original CRISPR CCGGGCGGAGACCCTCCTGA AGG Intergenic