ID: 1142123055

View in Genome Browser
Species Human (GRCh38)
Location 16:88396655-88396677
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123037_1142123055 29 Left 1142123037 16:88396603-88396625 CCCATCTGAAGGGAGGCCGGGAG No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data
1142123046_1142123055 2 Left 1142123046 16:88396630-88396652 CCCTCCTGAAGGGAGGCCGGGCG No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data
1142123038_1142123055 28 Left 1142123038 16:88396604-88396626 CCATCTGAAGGGAGGCCGGGAGG No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data
1142123040_1142123055 13 Left 1142123040 16:88396619-88396641 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data
1142123049_1142123055 -2 Left 1142123049 16:88396634-88396656 CCTGAAGGGAGGCCGGGCGGAGA No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data
1142123047_1142123055 1 Left 1142123047 16:88396631-88396653 CCTCCTGAAGGGAGGCCGGGCGG No data
Right 1142123055 16:88396655-88396677 GACCCTCCTGAAGGGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123055 Original CRISPR GACCCTCCTGAAGGGAGGCC GGG Intergenic