ID: 1142123056

View in Genome Browser
Species Human (GRCh38)
Location 16:88396657-88396679
Sequence CTCCCGGCCTCCCTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123056_1142123063 -3 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123063 16:88396677-88396699 GAGGAGACCCGTCTGAAGGGAGG No data
1142123056_1142123071 28 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123071 16:88396708-88396730 AAACCCTCCTGAAGGGAGGCCGG No data
1142123056_1142123066 5 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123066 16:88396685-88396707 CCGTCTGAAGGGAGGCCAGATGG No data
1142123056_1142123061 -7 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123061 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
1142123056_1142123072 29 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123072 16:88396709-88396731 AACCCTCCTGAAGGGAGGCCGGG No data
1142123056_1142123062 -6 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123062 16:88396674-88396696 CGGGAGGAGACCCGTCTGAAGGG No data
1142123056_1142123068 20 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123056_1142123070 24 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123070 16:88396704-88396726 ATGGAAACCCTCCTGAAGGGAGG No data
1142123056_1142123069 21 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123069 16:88396701-88396723 CAGATGGAAACCCTCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123056 Original CRISPR CTCCCGGCCTCCCTTCAGGA GGG (reversed) Intergenic