ID: 1142123060

View in Genome Browser
Species Human (GRCh38)
Location 16:88396673-88396695
Sequence CCTTCAGACGGGTCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123060_1142123072 13 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123072 16:88396709-88396731 AACCCTCCTGAAGGGAGGCCGGG No data
1142123060_1142123075 16 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123060_1142123068 4 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123060_1142123070 8 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123070 16:88396704-88396726 ATGGAAACCCTCCTGAAGGGAGG No data
1142123060_1142123071 12 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123071 16:88396708-88396730 AAACCCTCCTGAAGGGAGGCCGG No data
1142123060_1142123069 5 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123069 16:88396701-88396723 CAGATGGAAACCCTCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123060 Original CRISPR CCTTCAGACGGGTCTCCTCC CGG (reversed) Intergenic