ID: 1142123064

View in Genome Browser
Species Human (GRCh38)
Location 16:88396684-88396706
Sequence CATCTGGCCTCCCTTCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123064_1142123069 -6 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123069 16:88396701-88396723 CAGATGGAAACCCTCCTGAAGGG No data
1142123064_1142123075 5 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123064_1142123070 -3 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123070 16:88396704-88396726 ATGGAAACCCTCCTGAAGGGAGG No data
1142123064_1142123081 29 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123081 16:88396736-88396758 GACCCTCATAAAGGGAGGCCAGG No data
1142123064_1142123078 20 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123078 16:88396727-88396749 CCGGGAGGAGACCCTCATAAAGG No data
1142123064_1142123068 -7 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123064_1142123079 21 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123079 16:88396728-88396750 CGGGAGGAGACCCTCATAAAGGG No data
1142123064_1142123072 2 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123072 16:88396709-88396731 AACCCTCCTGAAGGGAGGCCGGG No data
1142123064_1142123080 24 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123080 16:88396731-88396753 GAGGAGACCCTCATAAAGGGAGG No data
1142123064_1142123071 1 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123071 16:88396708-88396730 AAACCCTCCTGAAGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123064 Original CRISPR CATCTGGCCTCCCTTCAGAC GGG (reversed) Intergenic