ID: 1142123068

View in Genome Browser
Species Human (GRCh38)
Location 16:88396700-88396722
Sequence CCAGATGGAAACCCTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123059_1142123068 16 Left 1142123059 16:88396661-88396683 CCTGAAGGGAGGCCGGGAGGAGA No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123065_1142123068 -8 Left 1142123065 16:88396685-88396707 CCGTCTGAAGGGAGGCCAGATGG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123064_1142123068 -7 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123056_1142123068 20 Left 1142123056 16:88396657-88396679 CCCTCCTGAAGGGAGGCCGGGAG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123057_1142123068 19 Left 1142123057 16:88396658-88396680 CCTCCTGAAGGGAGGCCGGGAGG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data
1142123060_1142123068 4 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123068 16:88396700-88396722 CCAGATGGAAACCCTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123068 Original CRISPR CCAGATGGAAACCCTCCTGA AGG Intergenic