ID: 1142123075

View in Genome Browser
Species Human (GRCh38)
Location 16:88396712-88396734
Sequence CCTCCTGAAGGGAGGCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123065_1142123075 4 Left 1142123065 16:88396685-88396707 CCGTCTGAAGGGAGGCCAGATGG No data
Right 1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123060_1142123075 16 Left 1142123060 16:88396673-88396695 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123059_1142123075 28 Left 1142123059 16:88396661-88396683 CCTGAAGGGAGGCCGGGAGGAGA No data
Right 1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123064_1142123075 5 Left 1142123064 16:88396684-88396706 CCCGTCTGAAGGGAGGCCAGATG No data
Right 1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123075 Original CRISPR CCTCCTGAAGGGAGGCCGGG AGG Intergenic