ID: 1142123107

View in Genome Browser
Species Human (GRCh38)
Location 16:88396835-88396857
Sequence CCTTCAGGAGGGTCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123107_1142123120 8 Left 1142123107 16:88396835-88396857 CCTGGAGGAGACCCTCCTGAAGG No data
Right 1142123120 16:88396866-88396888 GAGGACACCCTCCTGAAGGGAGG No data
1142123107_1142123125 16 Left 1142123107 16:88396835-88396857 CCTGGAGGAGACCCTCCTGAAGG No data
Right 1142123125 16:88396874-88396896 CCTCCTGAAGGGAGGCCGGGTGG No data
1142123107_1142123122 13 Left 1142123107 16:88396835-88396857 CCTGGAGGAGACCCTCCTGAAGG No data
Right 1142123122 16:88396871-88396893 CACCCTCCTGAAGGGAGGCCGGG No data
1142123107_1142123121 12 Left 1142123107 16:88396835-88396857 CCTGGAGGAGACCCTCCTGAAGG No data
Right 1142123121 16:88396870-88396892 ACACCCTCCTGAAGGGAGGCCGG No data
1142123107_1142123118 4 Left 1142123107 16:88396835-88396857 CCTGGAGGAGACCCTCCTGAAGG No data
Right 1142123118 16:88396862-88396884 CCGGGAGGACACCCTCCTGAAGG No data
1142123107_1142123119 5 Left 1142123107 16:88396835-88396857 CCTGGAGGAGACCCTCCTGAAGG No data
Right 1142123119 16:88396863-88396885 CGGGAGGACACCCTCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123107 Original CRISPR CCTTCAGGAGGGTCTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr