ID: 1142123136

View in Genome Browser
Species Human (GRCh38)
Location 16:88396916-88396938
Sequence CCTTCAGACGGGTCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123136_1142123148 13 Left 1142123136 16:88396916-88396938 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123148 16:88396952-88396974 GACCCTCATGAAGGGAGGCCAGG No data
1142123136_1142123147 8 Left 1142123136 16:88396916-88396938 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123147 16:88396947-88396969 GAGGAGACCCTCATGAAGGGAGG No data
1142123136_1142123146 5 Left 1142123136 16:88396916-88396938 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123146 16:88396944-88396966 CAGGAGGAGACCCTCATGAAGGG No data
1142123136_1142123145 4 Left 1142123136 16:88396916-88396938 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123145 16:88396943-88396965 CCAGGAGGAGACCCTCATGAAGG No data
1142123136_1142123151 16 Left 1142123136 16:88396916-88396938 CCGGGAGGAGACCCGTCTGAAGG No data
Right 1142123151 16:88396955-88396977 CCTCATGAAGGGAGGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123136 Original CRISPR CCTTCAGACGGGTCTCCTCC CGG (reversed) Intergenic