ID: 1142123152

View in Genome Browser
Species Human (GRCh38)
Location 16:88396970-88396992
Sequence CCTTCAGGAGGGTCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123152_1142123165 8 Left 1142123152 16:88396970-88396992 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142123165 16:88397001-88397023 GAGGAGACCCTCCTGAAGGGAGG No data
1142123152_1142123166 12 Left 1142123152 16:88396970-88396992 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142123166 16:88397005-88397027 AGACCCTCCTGAAGGGAGGCCGG No data
1142123152_1142123170 16 Left 1142123152 16:88396970-88396992 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142123170 16:88397009-88397031 CCTCCTGAAGGGAGGCCGGGAGG No data
1142123152_1142123164 5 Left 1142123152 16:88396970-88396992 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142123164 16:88396998-88397020 CGGGAGGAGACCCTCCTGAAGGG No data
1142123152_1142123163 4 Left 1142123152 16:88396970-88396992 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142123163 16:88396997-88397019 CCGGGAGGAGACCCTCCTGAAGG No data
1142123152_1142123167 13 Left 1142123152 16:88396970-88396992 CCAGGAGGAGACCCTCCTGAAGG No data
Right 1142123167 16:88397006-88397028 GACCCTCCTGAAGGGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123152 Original CRISPR CCTTCAGGAGGGTCTCCTCC TGG (reversed) Intergenic
No off target data available for this crispr