ID: 1142123162

View in Genome Browser
Species Human (GRCh38)
Location 16:88396997-88397019
Sequence CCTTCAGGAGGGTCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142123162_1142123173 8 Left 1142123162 16:88396997-88397019 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123173 16:88397028-88397050 GAGGAGACCCTCATGAAGACAGG No data
1142123162_1142123174 12 Left 1142123162 16:88396997-88397019 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123174 16:88397032-88397054 AGACCCTCATGAAGACAGGCCGG No data
1142123162_1142123178 16 Left 1142123162 16:88396997-88397019 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123178 16:88397036-88397058 CCTCATGAAGACAGGCCGGGAGG No data
1142123162_1142123175 13 Left 1142123162 16:88396997-88397019 CCGGGAGGAGACCCTCCTGAAGG No data
Right 1142123175 16:88397033-88397055 GACCCTCATGAAGACAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142123162 Original CRISPR CCTTCAGGAGGGTCTCCTCC CGG (reversed) Intergenic
No off target data available for this crispr