ID: 1142124307

View in Genome Browser
Species Human (GRCh38)
Location 16:88402604-88402626
Sequence GACCCAGGTCAACTGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142124307_1142124321 21 Left 1142124307 16:88402604-88402626 CCCCTTTGCAGTTGACCTGGGTC No data
Right 1142124321 16:88402648-88402670 CACCGTCACCTGCTTTCTCAGGG No data
1142124307_1142124313 -6 Left 1142124307 16:88402604-88402626 CCCCTTTGCAGTTGACCTGGGTC No data
Right 1142124313 16:88402621-88402643 TGGGTCTGCCCCCACGGTCAGGG No data
1142124307_1142124320 20 Left 1142124307 16:88402604-88402626 CCCCTTTGCAGTTGACCTGGGTC No data
Right 1142124320 16:88402647-88402669 CCACCGTCACCTGCTTTCTCAGG No data
1142124307_1142124312 -7 Left 1142124307 16:88402604-88402626 CCCCTTTGCAGTTGACCTGGGTC No data
Right 1142124312 16:88402620-88402642 CTGGGTCTGCCCCCACGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142124307 Original CRISPR GACCCAGGTCAACTGCAAAG GGG (reversed) Intergenic
No off target data available for this crispr