ID: 1142124757

View in Genome Browser
Species Human (GRCh38)
Location 16:88404699-88404721
Sequence CACTCACCCCTCTGGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142124757_1142124768 29 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124768 16:88404751-88404773 AGGGACCACAGGGCTGAGTCAGG No data
1142124757_1142124764 9 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124764 16:88404731-88404753 TTATGAGGAGAAAGGTAGCTAGG No data
1142124757_1142124765 10 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124765 16:88404732-88404754 TATGAGGAGAAAGGTAGCTAGGG No data
1142124757_1142124763 1 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124763 16:88404723-88404745 GAGTGGCATTATGAGGAGAAAGG No data
1142124757_1142124762 -6 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124762 16:88404716-88404738 TGAGTGTGAGTGGCATTATGAGG No data
1142124757_1142124767 19 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124767 16:88404741-88404763 AAAGGTAGCTAGGGACCACAGGG No data
1142124757_1142124766 18 Left 1142124757 16:88404699-88404721 CCGACCACCCAGAGGGGTGAGTG No data
Right 1142124766 16:88404740-88404762 GAAAGGTAGCTAGGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142124757 Original CRISPR CACTCACCCCTCTGGGTGGT CGG (reversed) Intergenic
No off target data available for this crispr