ID: 1142125076

View in Genome Browser
Species Human (GRCh38)
Location 16:88406143-88406165
Sequence GTCCCACCTTTGGCGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142125076_1142125084 3 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125084 16:88406169-88406191 CCAGGAAACCGCCCTTCCGTGGG No data
1142125076_1142125085 4 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125085 16:88406170-88406192 CAGGAAACCGCCCTTCCGTGGGG No data
1142125076_1142125090 21 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125090 16:88406187-88406209 GTGGGGCCCAGAGCTGAGTACGG No data
1142125076_1142125091 22 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125091 16:88406188-88406210 TGGGGCCCAGAGCTGAGTACGGG No data
1142125076_1142125096 30 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125096 16:88406196-88406218 AGAGCTGAGTACGGGAAATGGGG No data
1142125076_1142125095 29 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125095 16:88406195-88406217 CAGAGCTGAGTACGGGAAATGGG No data
1142125076_1142125082 2 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125082 16:88406168-88406190 CCCAGGAAACCGCCCTTCCGTGG No data
1142125076_1142125094 28 Left 1142125076 16:88406143-88406165 CCCGGCCTCGCCAAAGGTGGGAC No data
Right 1142125094 16:88406194-88406216 CCAGAGCTGAGTACGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142125076 Original CRISPR GTCCCACCTTTGGCGAGGCC GGG (reversed) Intergenic
No off target data available for this crispr