ID: 1142126570

View in Genome Browser
Species Human (GRCh38)
Location 16:88413546-88413568
Sequence CTCCAGAGGCCTGGGTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142126570_1142126577 9 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126577 16:88413578-88413600 CGTCCAGAGTGAGCCTCGGAGGG No data
1142126570_1142126580 25 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126580 16:88413594-88413616 CGGAGGGTGTCCTGCAGAGCTGG No data
1142126570_1142126576 8 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126576 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
1142126570_1142126582 27 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126582 16:88413596-88413618 GAGGGTGTCCTGCAGAGCTGGGG No data
1142126570_1142126574 5 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126570_1142126581 26 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126581 16:88413595-88413617 GGAGGGTGTCCTGCAGAGCTGGG No data
1142126570_1142126583 28 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142126570 Original CRISPR CTCCAGAGGCCTGGGTTCAC AGG (reversed) Intergenic