ID: 1142126574

View in Genome Browser
Species Human (GRCh38)
Location 16:88413574-88413596
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142126568_1142126574 9 Left 1142126568 16:88413542-88413564 CCTGCCTGTGAACCCAGGCCTCT No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126564_1142126574 20 Left 1142126564 16:88413531-88413553 CCGCCGTCCTGCCTGCCTGTGAA No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126567_1142126574 13 Left 1142126567 16:88413538-88413560 CCTGCCTGCCTGTGAACCCAGGC No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126561_1142126574 30 Left 1142126561 16:88413521-88413543 CCACTGGGCCCCGCCGTCCTGCC No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126565_1142126574 17 Left 1142126565 16:88413534-88413556 CCGTCCTGCCTGCCTGTGAACCC No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126562_1142126574 22 Left 1142126562 16:88413529-88413551 CCCCGCCGTCCTGCCTGCCTGTG No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126573_1142126574 -9 Left 1142126573 16:88413560-88413582 CCTCTGGAGAAGTGATTCCGTCC No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126571_1142126574 -3 Left 1142126571 16:88413554-88413576 CCCAGGCCTCTGGAGAAGTGATT No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126570_1142126574 5 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126563_1142126574 21 Left 1142126563 16:88413530-88413552 CCCGCCGTCCTGCCTGCCTGTGA No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data
1142126572_1142126574 -4 Left 1142126572 16:88413555-88413577 CCAGGCCTCTGGAGAAGTGATTC No data
Right 1142126574 16:88413574-88413596 ATTCCGTCCAGAGTGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142126574 Original CRISPR ATTCCGTCCAGAGTGAGCCT CGG Intergenic
No off target data available for this crispr