ID: 1142126575

View in Genome Browser
Species Human (GRCh38)
Location 16:88413577-88413599
Sequence CCTCCGAGGCTCACTCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142126575_1142126581 -5 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126581 16:88413595-88413617 GGAGGGTGTCCTGCAGAGCTGGG No data
1142126575_1142126580 -6 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126580 16:88413594-88413616 CGGAGGGTGTCCTGCAGAGCTGG No data
1142126575_1142126582 -4 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126582 16:88413596-88413618 GAGGGTGTCCTGCAGAGCTGGGG No data
1142126575_1142126583 -3 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data
1142126575_1142126585 13 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126585 16:88413613-88413635 CTGGGGGCAGCGTTATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142126575 Original CRISPR CCTCCGAGGCTCACTCTGGA CGG (reversed) Intergenic