ID: 1142126583

View in Genome Browser
Species Human (GRCh38)
Location 16:88413597-88413619
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142126573_1142126583 14 Left 1142126573 16:88413560-88413582 CCTCTGGAGAAGTGATTCCGTCC No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data
1142126578_1142126583 -7 Left 1142126578 16:88413581-88413603 CCAGAGTGAGCCTCGGAGGGTGT No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data
1142126570_1142126583 28 Left 1142126570 16:88413546-88413568 CCTGTGAACCCAGGCCTCTGGAG No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data
1142126575_1142126583 -3 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data
1142126571_1142126583 20 Left 1142126571 16:88413554-88413576 CCCAGGCCTCTGGAGAAGTGATT No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data
1142126572_1142126583 19 Left 1142126572 16:88413555-88413577 CCAGGCCTCTGGAGAAGTGATTC No data
Right 1142126583 16:88413597-88413619 AGGGTGTCCTGCAGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142126583 Original CRISPR AGGGTGTCCTGCAGAGCTGG GGG Intergenic