ID: 1142126585

View in Genome Browser
Species Human (GRCh38)
Location 16:88413613-88413635
Sequence CTGGGGGCAGCGTTATAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142126578_1142126585 9 Left 1142126578 16:88413581-88413603 CCAGAGTGAGCCTCGGAGGGTGT No data
Right 1142126585 16:88413613-88413635 CTGGGGGCAGCGTTATAGCAAGG No data
1142126579_1142126585 -1 Left 1142126579 16:88413591-88413613 CCTCGGAGGGTGTCCTGCAGAGC No data
Right 1142126585 16:88413613-88413635 CTGGGGGCAGCGTTATAGCAAGG No data
1142126573_1142126585 30 Left 1142126573 16:88413560-88413582 CCTCTGGAGAAGTGATTCCGTCC No data
Right 1142126585 16:88413613-88413635 CTGGGGGCAGCGTTATAGCAAGG No data
1142126575_1142126585 13 Left 1142126575 16:88413577-88413599 CCGTCCAGAGTGAGCCTCGGAGG No data
Right 1142126585 16:88413613-88413635 CTGGGGGCAGCGTTATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142126585 Original CRISPR CTGGGGGCAGCGTTATAGCA AGG Intergenic