ID: 1142127328

View in Genome Browser
Species Human (GRCh38)
Location 16:88416761-88416783
Sequence CTGGAAGGGCGAAGGGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142127328_1142127334 -9 Left 1142127328 16:88416761-88416783 CCACGCACCCTTCGCCCTTCCAG No data
Right 1142127334 16:88416775-88416797 CCCTTCCAGGGCTCCCTCCACGG No data
1142127328_1142127336 -8 Left 1142127328 16:88416761-88416783 CCACGCACCCTTCGCCCTTCCAG No data
Right 1142127336 16:88416776-88416798 CCTTCCAGGGCTCCCTCCACGGG No data
1142127328_1142127341 9 Left 1142127328 16:88416761-88416783 CCACGCACCCTTCGCCCTTCCAG No data
Right 1142127341 16:88416793-88416815 CACGGGACCCAGCCTGCAGAAGG No data
1142127328_1142127347 25 Left 1142127328 16:88416761-88416783 CCACGCACCCTTCGCCCTTCCAG No data
Right 1142127347 16:88416809-88416831 CAGAAGGGTCCTGCAGGAAGTGG No data
1142127328_1142127342 10 Left 1142127328 16:88416761-88416783 CCACGCACCCTTCGCCCTTCCAG No data
Right 1142127342 16:88416794-88416816 ACGGGACCCAGCCTGCAGAAGGG No data
1142127328_1142127345 19 Left 1142127328 16:88416761-88416783 CCACGCACCCTTCGCCCTTCCAG No data
Right 1142127345 16:88416803-88416825 AGCCTGCAGAAGGGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142127328 Original CRISPR CTGGAAGGGCGAAGGGTGCG TGG (reversed) Intergenic
No off target data available for this crispr