ID: 1142127641

View in Genome Browser
Species Human (GRCh38)
Location 16:88418123-88418145
Sequence CCCTGCCAGGCCCAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142127629_1142127641 14 Left 1142127629 16:88418086-88418108 CCCAGCTGGACTCTACCCGGGCT No data
Right 1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG No data
1142127631_1142127641 -1 Left 1142127631 16:88418101-88418123 CCCGGGCTCCTGAGCACCAACTC No data
Right 1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG No data
1142127628_1142127641 15 Left 1142127628 16:88418085-88418107 CCCCAGCTGGACTCTACCCGGGC No data
Right 1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG No data
1142127630_1142127641 13 Left 1142127630 16:88418087-88418109 CCAGCTGGACTCTACCCGGGCTC No data
Right 1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG No data
1142127632_1142127641 -2 Left 1142127632 16:88418102-88418124 CCGGGCTCCTGAGCACCAACTCC No data
Right 1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG No data
1142127633_1142127641 -9 Left 1142127633 16:88418109-88418131 CCTGAGCACCAACTCCCTGCCAG No data
Right 1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142127641 Original CRISPR CCCTGCCAGGCCCAGGATGG GGG Intergenic
No off target data available for this crispr