ID: 1142127869

View in Genome Browser
Species Human (GRCh38)
Location 16:88419209-88419231
Sequence CCGTGCCAAGCCACGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142127858_1142127869 9 Left 1142127858 16:88419177-88419199 CCCATCGGGGAGAGGCTAGCTGG No data
Right 1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG No data
1142127860_1142127869 8 Left 1142127860 16:88419178-88419200 CCATCGGGGAGAGGCTAGCTGGC No data
Right 1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG No data
1142127857_1142127869 14 Left 1142127857 16:88419172-88419194 CCACACCCATCGGGGAGAGGCTA No data
Right 1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142127869 Original CRISPR CCGTGCCAAGCCACGGAAGG GGG Intergenic
No off target data available for this crispr