ID: 1142130502

View in Genome Browser
Species Human (GRCh38)
Location 16:88429709-88429731
Sequence CTGGCCCACCGGCAGTTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142130495_1142130502 5 Left 1142130495 16:88429681-88429703 CCGCAACTACAGCAGCCTGGCGG 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 177
1142130498_1142130502 -10 Left 1142130498 16:88429696-88429718 CCTGGCGGCCTTCCTGGCCCACC 0: 1
1: 0
2: 3
3: 36
4: 364
Right 1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 177
1142130493_1142130502 21 Left 1142130493 16:88429665-88429687 CCTGCAGGCAGTGTGACCGCAAC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142130502 Original CRISPR CTGGCCCACCGGCAGTTCTG TGG Exonic
901087916 1:6622884-6622906 CTGGAACACTGGTAGTTCTGGGG + Exonic
903168259 1:21536380-21536402 CTGGCTGAGCTGCAGTTCTGAGG + Intronic
904947093 1:34207239-34207261 CTGCCACAGCAGCAGTTCTGCGG + Intronic
905898969 1:41568060-41568082 CTGGCACATAGGCAGTGCTGGGG - Intronic
906711114 1:47930569-47930591 CTGTCACACAGCCAGTTCTGAGG - Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
910930427 1:92437932-92437954 CTGACCCACCTCCAGTTCTGTGG - Intergenic
911853951 1:102853948-102853970 CGGGCGGACCGGCAGTGCTGAGG - Intergenic
917860618 1:179139668-179139690 CTGGGCCACAGACAGGTCTGTGG + Intronic
919386881 1:196933884-196933906 CTGGCCTGCCGGCACTGCTGGGG - Intronic
921147832 1:212376533-212376555 CTGGCCCCACAGCAGCTCTGAGG - Intronic
924707472 1:246511541-246511563 CTGGCCCATGGGCAGTTTTGGGG - Intergenic
1064513579 10:16121982-16122004 ATAGCCAACCGGCAGTTCTTGGG - Intergenic
1067732269 10:48820757-48820779 CTGGCCCAAGGGGGGTTCTGGGG + Intronic
1070148496 10:73791521-73791543 CTGGCCCAGGCTCAGTTCTGTGG - Intronic
1071275855 10:84054438-84054460 CAGGCCCAGCAGCAGGTCTGGGG - Intergenic
1072429140 10:95355877-95355899 CTGGCCCACCAGGAGGCCTGAGG + Intronic
1072439406 10:95440420-95440442 CTGCCCCACCTGCAGGTCTCAGG + Intronic
1073909574 10:108325806-108325828 CTGGCACCCTGGCACTTCTGCGG - Intergenic
1074976763 10:118587449-118587471 CAGGCCCACCAGCTGTTCTCTGG - Intergenic
1075666175 10:124232722-124232744 CTGGCCCACCCTCAGGTCTGTGG + Intergenic
1076086929 10:127640612-127640634 CTGGCCCTCTGCCAATTCTGTGG + Intergenic
1076236126 10:128864867-128864889 CTGGTACAACTGCAGTTCTGGGG + Intergenic
1076585574 10:131545254-131545276 TTGGCCCACCGGCTGTGCCGGGG - Intergenic
1077341483 11:2028279-2028301 CTGGCCCTCGGGCAGTTTCGAGG + Intergenic
1077488577 11:2850209-2850231 CTGGCCCACAGGGAGCTCCGTGG + Intergenic
1078895139 11:15591273-15591295 CTGGGCCATTGACAGTTCTGTGG - Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1084289202 11:68151037-68151059 CTGGAACACTGGCAGCTCTGTGG + Intergenic
1084430257 11:69106914-69106936 CTGTCCCACCTGCCTTTCTGTGG - Intergenic
1088357636 11:108960325-108960347 CTGGGCTGCAGGCAGTTCTGAGG - Intergenic
1090505629 11:127310549-127310571 CTGGCCCATGGGAAGTTGTGAGG - Intergenic
1202824469 11_KI270721v1_random:83468-83490 CTGGCCCTCGGGCAGTTTCGAGG + Intergenic
1091647376 12:2284124-2284146 CTGGCCCTCAGGAAGTGCTGAGG + Intronic
1093489020 12:19683701-19683723 CTGACTCACAGGCAGTTCTGAGG - Intronic
1094508598 12:31082421-31082443 CTCCCCCACCTGCAGCTCTGTGG - Intronic
1095954601 12:47798905-47798927 CTGGCCCACCCGCAGGTCCATGG + Exonic
1096045722 12:48560368-48560390 CTGGCTCAGCAGCACTTCTGCGG + Intergenic
1097183548 12:57184422-57184444 CTGGCCCAACGGCATCTCAGTGG + Exonic
1097191843 12:57223054-57223076 CTGGCCCACAGGCTGTGCTGTGG - Intronic
1099496309 12:83351181-83351203 CTAGCCAACCTGGAGTTCTGTGG + Intergenic
1103834145 12:123805562-123805584 GTGGCCCACAGACTGTTCTGGGG + Intronic
1104373885 12:128247415-128247437 CTGGCAGGCCGGCAGTGCTGGGG - Intergenic
1105876139 13:24555037-24555059 CAGGCCCACCCGCAGTTATCTGG - Intergenic
1106466881 13:30021337-30021359 CTTGCCCATCTGCGGTTCTGGGG + Intergenic
1112920886 13:104611563-104611585 CTGGACCATTGGCATTTCTGGGG + Intergenic
1113775395 13:112942126-112942148 CAGGCCCACCCGCAGTTATCTGG + Intronic
1114525961 14:23366810-23366832 CCTGCCCGCCTGCAGTTCTGGGG - Intergenic
1115821279 14:37214948-37214970 CAGGCCCACCCGCAGTTATCCGG + Intronic
1116137070 14:40939706-40939728 CTGGACAACCTGGAGTTCTGAGG - Intergenic
1126061220 15:44784670-44784692 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1126978783 15:54217550-54217572 CTGGCCCACCTGCTGCCCTGTGG - Intronic
1129732217 15:77939029-77939051 CTGTCCCAGAGGCAGGTCTGAGG - Intergenic
1129921127 15:79319972-79319994 CAGGCCCACCCGCAGTTATCCGG - Intronic
1131208555 15:90473196-90473218 CTGGCACAGTGGCAGTTCTTGGG + Intronic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1137817980 16:51417316-51417338 CTGGAACACTGGCAGTCCTGGGG + Intergenic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1141664337 16:85458185-85458207 CTGGACCCCCTGCAGCTCTGGGG + Intergenic
1141947815 16:87322610-87322632 GTGGCTCCCCTGCAGTTCTGGGG - Intronic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1142347242 16:89561604-89561626 CCGGACCATCGGCATTTCTGTGG + Exonic
1143646865 17:8235868-8235890 CTTGCCTACCAGCAGTTCCGTGG - Exonic
1144653811 17:17022720-17022742 CTGGCCCAGAGGCAGTGCTCAGG - Intergenic
1144708162 17:17383718-17383740 CCGGACCATCGGCATTTCTGTGG - Intergenic
1145147769 17:20495317-20495339 CTGGCCCAGGAGCTGTTCTGGGG + Intergenic
1148220640 17:45859322-45859344 CTCGCCCTCCGGAAGTGCTGGGG - Intergenic
1150211203 17:63442506-63442528 CTGGGACACCGGCTGTTCTTGGG + Intronic
1151268264 17:72973304-72973326 GTGCCCCCCCGGCAGTGCTGGGG - Intronic
1151957228 17:77386444-77386466 GTGGCCCACAGGCAGGTCAGAGG + Intronic
1152867610 17:82733822-82733844 CTGTCCTACCTGCTGTTCTGCGG + Intergenic
1158560957 18:58513328-58513350 CTGGCCCAGAGGCCCTTCTGAGG + Intronic
1160708048 19:539029-539051 TTGGCCCACAGGGAGTTTTGAGG - Intronic
1160816510 19:1038462-1038484 CTGGCCCCGGGGCAGGTCTGAGG - Exonic
1161312144 19:3600610-3600632 GTGGCCCAACGGCAGTTCCCTGG - Exonic
1163533510 19:17864033-17864055 CTGGGCCAGCGGCCCTTCTGGGG + Intronic
1164158291 19:22609902-22609924 CTGGGTGACTGGCAGTTCTGTGG + Intergenic
1164538968 19:29108001-29108023 ATGGCCAACCAGCAGGTCTGTGG + Intergenic
1164611130 19:29632434-29632456 CTGGACCACCTGCCTTTCTGTGG + Intergenic
1165769605 19:38371413-38371435 CTGGACCACAGGGAGGTCTGGGG - Intergenic
1167592277 19:50410468-50410490 CCCACCCACCCGCAGTTCTGGGG + Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1168603399 19:57738701-57738723 CAGGCCCACCCGCAGTTATCCGG + Intronic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
928033735 2:27802592-27802614 CTGGGCCACTGGTAGTTCTTTGG - Intronic
928082347 2:28322514-28322536 TTGGCCCAGCAGCACTTCTGGGG - Intronic
928170669 2:29001072-29001094 CTGGCCCCCGGGCAGTGCTGGGG + Intronic
929776991 2:44935948-44935970 CAGGCCCACCGGCTGCTCAGGGG - Intergenic
930115717 2:47716700-47716722 CAGGCCCACCCGCAGTTATCCGG + Intronic
932221005 2:69998978-69999000 CTGGCCCAGAGACAGTCCTGTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935705424 2:105852313-105852335 GTGGCCCAGGGGAAGTTCTGTGG + Intronic
936022581 2:109006057-109006079 TTGGCCCACCGGCAGTCACGTGG + Intergenic
937340829 2:121089343-121089365 CTGACTCAGAGGCAGTTCTGGGG - Intergenic
937983667 2:127629051-127629073 CTGGCCCAGCGGGGGTCCTGGGG - Intronic
946454455 2:219812966-219812988 ATGGACCAACTGCAGTTCTGGGG + Intergenic
946929149 2:224655471-224655493 CAGGCCGGCCGGCAGTGCTGGGG - Intergenic
948389318 2:237600731-237600753 ATGGCCCACGGGCAGGCCTGGGG + Intronic
948797276 2:240411524-240411546 CTCGCCCACGGTCACTTCTGGGG + Intergenic
1169430079 20:5528674-5528696 CTGGCACACCAGCAGAACTGAGG + Intergenic
1172107089 20:32523245-32523267 CTGGCCCTCAGGCAGTTCCAAGG - Intronic
1174453251 20:50632421-50632443 CTGGCTCACCTGCAGAGCTGGGG - Intronic
1175143004 20:56874380-56874402 CTGACCCACGGGGAGCTCTGGGG + Intergenic
1175648495 20:60696243-60696265 ATGGCTCACTGGCAGCTCTGGGG - Intergenic
1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG + Intronic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1183108490 22:35631058-35631080 CTGGTCCACCGGGCCTTCTGTGG - Intronic
1183694787 22:39415583-39415605 CTGGCCCAGCAGGAGCTCTGCGG - Exonic
1184060330 22:42077598-42077620 CTGGGCCGCCGGCCCTTCTGCGG - Exonic
1184405920 22:44300788-44300810 CTGGCCCATCTGGGGTTCTGGGG - Intronic
1184717077 22:46288417-46288439 CTGGCCCACAGACACTCCTGAGG - Exonic
949292760 3:2485081-2485103 CTGGCCGGCCGGCACTGCTGGGG - Intronic
949895259 3:8763529-8763551 CTGACCCTGGGGCAGTTCTGAGG - Intronic
950478897 3:13232559-13232581 CTGGCCCGGCTGCAGGTCTGGGG + Intergenic
950689490 3:14644195-14644217 CTGGCCCACCTGCAGCGATGCGG - Intergenic
952180820 3:30914667-30914689 CTGGCACACTGGAAGTCCTGAGG + Intergenic
955219673 3:57013036-57013058 CAGGCCGGCCGGCAGTGCTGGGG - Intronic
956173507 3:66452054-66452076 CTGGCTCACATGGAGTTCTGAGG + Intronic
960160953 3:114350361-114350383 CTTGCCCACTGGCTGTGCTGTGG + Exonic
961601977 3:128069420-128069442 CTGGCTCACGGGGAGCTCTGTGG + Intronic
961626732 3:128269306-128269328 CAGGCCCCATGGCAGTTCTGTGG + Intronic
961785720 3:129345411-129345433 CTGGCCCAGGGAGAGTTCTGGGG - Intergenic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
964056079 3:152459821-152459843 CTGGCCCACAGGCAGTAGTTTGG + Intronic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
967986006 3:195095730-195095752 CTGCCCCACCCGCAGATCAGGGG - Intronic
968350909 3:198051172-198051194 CAGGCCCACCCGCAGTTATCCGG + Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
969860861 4:10034357-10034379 CTGGCACACCTGCAGTTTCGAGG + Intronic
979525486 4:121711857-121711879 CTGTCCCTCCGGCAGCTGTGAGG - Intergenic
979654998 4:123181688-123181710 TTGGCCCACTGGCTGTTTTGGGG + Intronic
979678605 4:123435557-123435579 CAGGCCAGCCGGCAGTGCTGGGG + Intergenic
981580259 4:146243319-146243341 CAGCCCCACCGCCAGTGCTGTGG - Intergenic
982082878 4:151807481-151807503 CTGGCACACCGCCAGTAATGAGG - Intergenic
982199846 4:152949741-152949763 CTGGCCCCCTGGCAGTTGCGGGG + Intronic
982840158 4:160174596-160174618 CTGGCCCACAGGGACTCCTGGGG + Intergenic
984805333 4:183746628-183746650 CGGGCCCGCCGGCAGTGCTGGGG + Intergenic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
1001018420 5:168162504-168162526 CTGGCCCAGCGGCTGCCCTGCGG + Intronic
1001561147 5:172669808-172669830 CTGGCCACCCGGCCGTGCTGCGG + Exonic
1002550841 5:179990503-179990525 CAGGCCCACCCGCAGTTATCTGG - Intronic
1006450677 6:34104121-34104143 CTGGCCCACAGACAGCACTGTGG - Intronic
1014806936 6:125840072-125840094 CTGTCCCACTGGAAGTTCTCAGG - Intronic
1015760627 6:136656382-136656404 CTTGGCCACAGGCTGTTCTGTGG + Exonic
1018582734 6:165321487-165321509 CTGGTCCACAGGCAGAGCTGCGG + Intergenic
1019960868 7:4458334-4458356 CTTGCCCTCCCGCAGTTGTGCGG - Intergenic
1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG + Intergenic
1022773537 7:33500592-33500614 CTGGCCCACAGTCAGTCCTCAGG + Intronic
1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG + Intergenic
1023939996 7:44763144-44763166 CTGACCCACTGACAGCTCTGAGG - Intronic
1024993735 7:55255238-55255260 CTCGCCCACCGGCAGTTGCCCGG + Intronic
1027126059 7:75557558-75557580 CTGCTCCATGGGCAGTTCTGTGG - Intronic
1035240777 7:157527856-157527878 CTCACCCACCGGCAGGGCTGCGG + Intergenic
1035324374 7:158055477-158055499 CAGGCCCACCCGCAGTTATCCGG + Intronic
1036645921 8:10611445-10611467 CTGGCCCCCGGGCAGTGCTTTGG + Exonic
1040318159 8:46275820-46275842 GTGGCCCTCCCGCAGTTTTGTGG + Intergenic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG + Intronic
1049223795 8:141440163-141440185 CCGGTGCACCGGCTGTTCTGTGG + Intergenic
1049881355 8:145066302-145066324 CAGGCCCACCCGCAGTTATCCGG + Intergenic
1049905751 9:214956-214978 ATGGCCCGCCGGCGGTTCGGTGG - Exonic
1050294920 9:4195471-4195493 CTGGCGGGCCGGCAGTGCTGGGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055839019 9:80480079-80480101 CTGCCCTCCCTGCAGTTCTGAGG - Intergenic
1056548640 9:87633967-87633989 TTGGCCAACAGGGAGTTCTGGGG + Intronic
1056914034 9:90729656-90729678 CTGGCCCACCGGCACTGCACTGG + Intergenic
1060553996 9:124499062-124499084 CTGACCCCCTGGCTGTTCTGGGG - Intronic
1061682975 9:132252571-132252593 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1061866108 9:133492519-133492541 CTGGGCCACCTGCAGCCCTGGGG - Intergenic
1061904741 9:133690843-133690865 CTGGCCCAGATGCAGTTCTGCGG + Intronic
1061920350 9:133779167-133779189 GTGGCCCACAGGCAGCTGTGCGG + Intronic
1061985161 9:134126380-134126402 CCGGCCCCCCGGTAGGTCTGGGG - Intergenic
1190266065 X:48827614-48827636 CTGGCGCAGCGGCAGTTTGGGGG - Intergenic
1193678835 X:84491856-84491878 CTGGTCCTCCGTGAGTTCTGAGG + Intronic
1195825639 X:108997516-108997538 CTGGCCCATGGGCAGTAGTGTGG + Intergenic
1197732835 X:129826705-129826727 CTGGCACAGCTGGAGTTCTGGGG - Intronic
1200338118 X:155373927-155373949 CTAGCCCACAGGCAATCCTGTGG + Intergenic
1200348351 X:155466765-155466787 CTAGCCCACAGGCAATCCTGTGG - Intergenic