ID: 1142131031

View in Genome Browser
Species Human (GRCh38)
Location 16:88431556-88431578
Sequence TGGCAACTGGAACCCCCAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142131031_1142131044 26 Left 1142131031 16:88431556-88431578 CCCCTTGGGGGTTCCAGTTGCCA 0: 1
1: 0
2: 1
3: 8
4: 114
Right 1142131044 16:88431605-88431627 CCCCACAGTGAGTTGTTCCTCGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142131031 Original CRISPR TGGCAACTGGAACCCCCAAG GGG (reversed) Exonic
905969670 1:42131964-42131986 TGGCAATTGGACATCCCAAGAGG - Intergenic
906572584 1:46856801-46856823 TGGCAACAGAATCACCCAAGTGG + Intergenic
906599190 1:47109090-47109112 TGGCAACAGAATCACCCAAGTGG - Intronic
911033977 1:93519380-93519402 GGGCAACTGGAAACCCCTGGGGG - Intronic
918313590 1:183304397-183304419 TGGCAGCTGGATTTCCCAAGGGG + Intronic
918932405 1:190871817-190871839 TACCAACAGGAACCCCCATGTGG + Intergenic
919848858 1:201658966-201658988 TGGCAACTGGAACAGCCTGGTGG - Intronic
920298795 1:204975961-204975983 TGCACACTGGAACCCCCAGGGGG - Intronic
920397940 1:205660166-205660188 TGGCATCTGGGACCCCAGAGAGG - Intronic
920570929 1:207016711-207016733 TGCCAACTGGGACCCCCATCAGG - Intronic
924037205 1:239949659-239949681 TGGCTACTGGAAAAGCCAAGTGG - Intergenic
924625903 1:245696255-245696277 TGGCAGCTGGCATCCCCCAGAGG - Intronic
924799359 1:247316379-247316401 TGGAAACTTGATCCCCCATGTGG + Intronic
1063017380 10:2092604-2092626 GGGAAACTGGAACCAGCAAGTGG - Intergenic
1067045843 10:42984815-42984837 TGGCAAGTGCCACCCCCATGAGG + Intergenic
1073186632 10:101618963-101618985 TGGCAGCTGGAAGGCCCAAGTGG - Intronic
1074906492 10:117868794-117868816 AGGCAAATGCAACCACCAAGTGG - Intergenic
1075514208 10:123096359-123096381 GGGTTACTGGAAACCCCAAGTGG - Intergenic
1075976561 10:126701254-126701276 TGGCCACTGGAACACCCAGTAGG - Intergenic
1077113717 11:873329-873351 TGGTAACTGGGACCCCCTTGAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080901157 11:36492888-36492910 TGGGAACTGGCACCCTCTAGTGG + Intronic
1081696159 11:45110529-45110551 TGTGAGCTGGAACCGCCAAGGGG + Intronic
1083726713 11:64632205-64632227 AGACAACTGGACCCCACAAGTGG - Intronic
1087260169 11:96002349-96002371 AGGCAACTGGAAAACCAAAGTGG + Intronic
1089005979 11:115091146-115091168 TGGCAACTGCAAACACCAAGAGG + Intergenic
1091108386 11:132943630-132943652 TCGCATCTGGAACCCCAAGGCGG + Exonic
1091143668 11:133258601-133258623 TGGCAACTGTGACCTCTAAGTGG - Intronic
1092195897 12:6549625-6549647 TGGCAACTGGGGCCCTCACGGGG - Intronic
1098188710 12:67925360-67925382 TGGCAATTGGCCACCCCAAGTGG + Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1102626042 12:114236233-114236255 TGGAAACTGGGACCCAAAAGGGG - Intergenic
1103871917 12:124098433-124098455 TGGTAAGTGGAATACCCAAGGGG - Intronic
1104023793 12:125011614-125011636 TGGCAACTGGAATCCCCCTCCGG - Intronic
1105044173 12:132987740-132987762 GACCAACTGGAACCCTCAAGAGG + Intronic
1106132435 13:26951526-26951548 TGGCAGCAGGAAACCCCAGGTGG - Intergenic
1108579639 13:51817692-51817714 AGGCATCTGGAATTCCCAAGTGG + Intergenic
1108674986 13:52728822-52728844 TGAGAACTGAAACCCCCATGGGG + Intronic
1111488509 13:88937547-88937569 TGGCAACTGCAACCCTCACTGGG - Intergenic
1115428702 14:33290993-33291015 TGGCAAGTGGAATCTACAAGTGG + Intronic
1116171224 14:41405699-41405721 TATTAACTGGAACCCTCAAGGGG + Intergenic
1122092316 14:99348787-99348809 TGCTAAATGGAACCCCCTAGAGG + Intergenic
1202919584 14_KI270723v1_random:18649-18671 AGGCAACTGAAAACACCAAGGGG + Intergenic
1128395709 15:67223299-67223321 TGGCTACTGAGACCTCCAAGTGG - Intronic
1130917020 15:88313144-88313166 TAGCAGCTGAAAACCCCAAGTGG - Intergenic
1141508835 16:84499468-84499490 TGACAACTCAAACCCTCAAGGGG + Intronic
1142131031 16:88431556-88431578 TGGCAACTGGAACCCCCAAGGGG - Exonic
1146059407 17:29596586-29596608 TGGCAACCAGAACCCTGAAGTGG + Intronic
1146510571 17:33444582-33444604 AGGCAACTGGAAATCCCAACCGG - Intronic
1146538645 17:33675349-33675371 TGGCATCAGGAATTCCCAAGGGG + Intronic
1149210243 17:54292627-54292649 TGGCAAATGAAACACTCAAGAGG + Intergenic
1152643924 17:81460233-81460255 TTGCAGCTGGAACCCCCAGTAGG - Intronic
1154327152 18:13399641-13399663 TGGCAAATGGGACGCCCATGTGG - Intronic
1155785687 18:29897378-29897400 CTGCAACTGGCAGCCCCAAGAGG - Intergenic
1156622899 18:38873737-38873759 TGCCAGCTGCCACCCCCAAGTGG - Intergenic
1159327073 18:66936136-66936158 TGGCCACAGGATCCCCTAAGTGG + Intergenic
1162809688 19:13156186-13156208 GGGCACCGGAAACCCCCAAGAGG - Intergenic
1163681130 19:18683356-18683378 GGGGCACTGGAGCCCCCAAGAGG - Intergenic
1163711795 19:18851516-18851538 TGGCAACCGGAAAATCCAAGTGG - Intronic
928379525 2:30805631-30805653 AGGAAACTGGGACCCCCAAGAGG + Intronic
931507187 2:62942567-62942589 CGACAACTGTAACCTCCAAGAGG - Intronic
932300993 2:70666952-70666974 TGGCCAGTGGAACCCTCCAGTGG - Intronic
935210546 2:100936227-100936249 TGGCAGCGGGAACCCGGAAGAGG - Intronic
935688858 2:105712305-105712327 TGGCCACTGGAACCCCCAGGGGG - Intergenic
937287277 2:120761517-120761539 TTGCAACTGGAACCCAGAGGGGG + Intronic
940677769 2:156746234-156746256 TGGCAACTAAAACCCCAAACAGG + Intergenic
942418979 2:175788027-175788049 TGGCATCTGGAACCAGGAAGAGG + Intergenic
948252015 2:236536895-236536917 AGGCACCTAGAACCCTCAAGGGG - Intergenic
1170366225 20:15601176-15601198 TGACAACTGGAACCCCAGTGAGG - Intronic
1172784784 20:37460638-37460660 TGGCAGCTGGCTTCCCCAAGAGG + Intergenic
1173557104 20:43973979-43974001 TGGCAACTATGACCCCCCAGAGG - Intronic
1177868890 21:26546581-26546603 CCCCAACTGGAACCCCCAAATGG + Intronic
1178193299 21:30312404-30312426 TGGCAAGTGGAACCTCTAAGTGG + Intergenic
1183305784 22:37082330-37082352 TGGCAAATGGAGTCGCCAAGGGG + Intronic
1184430422 22:44438908-44438930 TGGACACTCGAACTCCCAAGAGG + Intergenic
951105414 3:18736412-18736434 TTTCAAGTGGAACCCCCAAGAGG - Intergenic
954567487 3:51610793-51610815 TGCCAGTTGGAACCCCTAAGAGG + Intronic
955957136 3:64302552-64302574 TGGCAACTAGAATCACAAAGAGG + Intronic
956042213 3:65156377-65156399 TGGCAACTGGCTTCCCCCAGAGG + Intergenic
956860781 3:73321712-73321734 TGACAAATGGAGGCCCCAAGAGG - Intergenic
959020004 3:101178459-101178481 TGGCAGTTGAACCCCCCAAGAGG - Intergenic
959614686 3:108334136-108334158 AGGCAACTGGAGACTCCAAGTGG + Intronic
960487805 3:118274424-118274446 TTGAAACTCTAACCCCCAAGTGG - Intergenic
961519400 3:127457988-127458010 GGGCAACTGGAACCCTCAGATGG - Intergenic
979758653 4:124373519-124373541 TGGCAACTGGAACACTCAGTTGG + Intergenic
982044337 4:151427872-151427894 AAGCAACTGGAATGCCCAAGAGG - Intronic
986076746 5:4345502-4345524 TGGCAACTGAAACCCCATTGTGG + Intergenic
989146119 5:38251755-38251777 TGGAAACTGGCACTCCCAAGGGG - Intergenic
989643301 5:43603570-43603592 TGGGAACTGGGTCCCCGAAGAGG + Intronic
991133120 5:63149320-63149342 AGGCAAAGGGAAACCCCAAGAGG - Intergenic
992330901 5:75716787-75716809 ATTCAAATGGAACCCCCAAGAGG + Intronic
994632880 5:102307888-102307910 TGGCAAGTGGAAACCCCATATGG - Intergenic
997507488 5:134429413-134429435 TAGAAACTGGACCCCCAAAGAGG - Intergenic
999150720 5:149424325-149424347 TGGAACCTGGGACCCCCAAGCGG + Intergenic
999196379 5:149784337-149784359 TGGCAGCAGGAAGCCCCATGAGG - Intronic
1001381049 5:171306977-171306999 TGCCAACTCCAGCCCCCAAGTGG + Exonic
1001956847 5:175853625-175853647 TAGCAACTTGAACCCATAAGAGG + Intronic
1002818742 6:702675-702697 AGACAACTGGAACTCTCAAGAGG - Intergenic
1003237393 6:4308569-4308591 AGGCAAATGGAAACTCCAAGTGG + Intergenic
1007045537 6:38770151-38770173 TGACAATTAGAACTCCCAAGAGG - Intronic
1008617466 6:53240461-53240483 AGGCAACAAGAAACCCCAAGTGG + Intergenic
1015437199 6:133203001-133203023 TGGCAGCTGGGACCCTCAGGAGG + Intergenic
1017203875 6:151784694-151784716 TGGCAGCTGGAACCCAGGAGGGG - Intronic
1019358067 7:591280-591302 TGGGCACTGGGACCCCCACGTGG + Intronic
1022232561 7:28428402-28428424 TGGCAGCTGGAAGACCCATGAGG + Intronic
1022843876 7:34190889-34190911 TGGCAACTGGAATCCACAGTCGG - Intergenic
1023125627 7:36951512-36951534 TGGCCACTGGAACCACCTGGAGG + Intronic
1024784423 7:52890724-52890746 AGAGAACTGGAAGCCCCAAGTGG + Intergenic
1032485541 7:132284582-132284604 TGTCCACTAGAACACCCAAGGGG + Intronic
1032759725 7:134928711-134928733 TGGCAAGTGGCACGCTCAAGAGG + Intronic
1034397763 7:150840167-150840189 AGGCAACTGGAACCCACCAGAGG + Intronic
1034973967 7:155437186-155437208 TGTCCACTTGGACCCCCAAGTGG - Intergenic
1047690541 8:127349257-127349279 TGGCAATTAGAAGCCCCAAAGGG + Intergenic
1049917970 9:336766-336788 TGGGCACTGGAACCCACAGGAGG + Intronic
1050261835 9:3849113-3849135 TGGCAACTGGAAACTCCAGAGGG + Intronic
1055310882 9:74978394-74978416 TGCCACCTGGAACTCCCAACTGG + Intergenic
1055931502 9:81564245-81564267 TGGCAACTGGCTTCCCCAAAAGG + Intergenic
1062219878 9:135409458-135409480 TGGCAGCTGGAATCCCCTTGGGG - Intergenic
1062539552 9:137035553-137035575 TGGCCAAGGGGACCCCCAAGTGG + Exonic
1187355318 X:18564408-18564430 AGGCAACTGGAATCCCCAGTCGG + Intronic
1189438902 X:41017078-41017100 TGGTAATTGGAACCCAAAAGGGG + Intergenic
1192262193 X:69512076-69512098 TGGCAGCTGGAATCCACATGTGG - Intronic
1195836868 X:109125506-109125528 TGGCCATTGGAACCACCAGGTGG - Intergenic
1198330009 X:135613721-135613743 TGGCATCTGGAAACAACAAGAGG - Intergenic