ID: 1142131301

View in Genome Browser
Species Human (GRCh38)
Location 16:88432773-88432795
Sequence TTCCCTGTGAACAGAGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142131295_1142131301 13 Left 1142131295 16:88432737-88432759 CCAGCTCACAAGAAAGTGAAGAC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 40
4: 350
1142131294_1142131301 16 Left 1142131294 16:88432734-88432756 CCGCCAGCTCACAAGAAAGTGAA 0: 1
1: 0
2: 0
3: 23
4: 228
Right 1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 40
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142131301 Original CRISPR TTCCCTGTGAACAGAGAGGA GGG Exonic
900720639 1:4173674-4173696 TTCACTGAGATCAGAAAGGAGGG - Intergenic
900826716 1:4932909-4932931 TTCTATGTGGACTGAGAGGAAGG - Intergenic
902290317 1:15430988-15431010 TGCCAGGTGAGCAGAGAGGAGGG + Intergenic
903280253 1:22246038-22246060 TTCCCAGGGTACAGACAGGAGGG - Intergenic
905960560 1:42038981-42039003 TGCCTTGAGAACACAGAGGAAGG - Intergenic
907586801 1:55625584-55625606 TTCCCTGTAATCAGAAAGAAAGG + Intergenic
907873027 1:58460126-58460148 CTCCCTTTGAGCAGAGAGCATGG + Intronic
908106495 1:60848554-60848576 TTCCCTGGGAAAAAACAGGAGGG + Intergenic
908777366 1:67653455-67653477 GTCCCTGGGAGAAGAGAGGATGG - Intergenic
909541153 1:76792879-76792901 TTCCCTAGGAAAAGAGAGGAAGG - Intergenic
909892412 1:81024121-81024143 TTTCCTGTGCAAATAGAGGAGGG - Intergenic
910163957 1:84303233-84303255 TTCCATGTCAACAGATAGCATGG - Exonic
910438174 1:87226581-87226603 TTGGCTGAGAACAGAGAGGGAGG + Intergenic
910450323 1:87337035-87337057 TCCCCTTTTACCAGAGAGGAAGG - Intronic
912520765 1:110243225-110243247 CTCACTGTGGACTGAGAGGATGG + Intronic
913050086 1:115109820-115109842 ATCCCTGTGATGAGAGAGCAGGG - Intergenic
913265125 1:117036002-117036024 GTCCATGTGAGCAGAGAGGAGGG - Intronic
913614074 1:120538885-120538907 TTCCCTGTAAACTGAAAGCAAGG - Intergenic
914464946 1:147919197-147919219 CTGCTTGTGAACAGAGAGTAGGG + Intergenic
914576194 1:148972008-148972030 TTCCCTGTAAACTGAAAGCAAGG + Intronic
915932228 1:160067927-160067949 TTCCTTGGGACCAGAGAGGCTGG - Intronic
916667152 1:166976500-166976522 TGCCTTGGGAACATAGAGGAAGG + Intronic
917610003 1:176679576-176679598 TGCCCTGTGAAAAGAGAAGGGGG - Intronic
917708498 1:177659319-177659341 TTCTCTTTGAACAGAAGGGAGGG - Intergenic
918150601 1:181795227-181795249 TTTCCGGTGAACACAGAGGAGGG - Intronic
919323715 1:196078911-196078933 TTCTCAGTTGACAGAGAGGAAGG + Intergenic
920569689 1:207007286-207007308 TACCCTGGGCCCAGAGAGGAGGG + Intronic
920728577 1:208461380-208461402 TGCCTTGTCCACAGAGAGGAGGG + Intergenic
921070511 1:211654386-211654408 TTCCCTGTGTAGAGGGAGGGAGG + Intergenic
921166311 1:212510175-212510197 TTCCATGCAAAAAGAGAGGAGGG + Intergenic
921500420 1:215895659-215895681 TGCACTGTGAACAGAGGAGAGGG - Intronic
922418060 1:225439557-225439579 TTCAATGTGTACAGAGATGATGG - Intergenic
924627758 1:245709973-245709995 TTCCCTCTGAACAGTAATGAGGG + Intergenic
924837465 1:247666862-247666884 ACCCTTGTGAAGAGAGAGGATGG + Intergenic
1063034324 10:2270438-2270460 CTGCCTGAGAACATAGAGGAAGG + Intergenic
1064573925 10:16724996-16725018 CTACCTTTGAGCAGAGAGGAAGG + Intronic
1064651879 10:17517534-17517556 ATACCTGTGAAAAGAGAGAAAGG - Intergenic
1065067392 10:21984444-21984466 ATCCCAGTGAACAGAAAAGAAGG + Intronic
1065939755 10:30553657-30553679 TTACATGTGAAAAGATAGGAGGG - Intergenic
1066120985 10:32287063-32287085 TTCTCTATGAACATTGAGGAGGG - Intronic
1068910218 10:62372305-62372327 TCCCCTGTTAAATGAGAGGATGG - Intergenic
1070495870 10:77021719-77021741 TTCCCTGTGAACAGGGGTGAGGG + Intronic
1070559538 10:77555445-77555467 TTCCCTGTTAGAAGAGAGGTTGG - Intronic
1070667320 10:78354430-78354452 TCCCCAGTGCACAGGGAGGAGGG + Intergenic
1070693126 10:78542475-78542497 TTCCCAGATAACAGACAGGAGGG - Intergenic
1070931062 10:80260786-80260808 TTCCCTGTGGACAGAGGAGGGGG - Intergenic
1071332024 10:84570350-84570372 GTCCCTGAGACTAGAGAGGAGGG + Intergenic
1071829867 10:89360943-89360965 TGCCATGTGAAGAGAGAGCATGG - Intronic
1071958514 10:90785045-90785067 TTCCCTGAGAACTCAGAGCAGGG - Intronic
1073505550 10:103985264-103985286 TTCCCTGGGGATAGAGGGGACGG + Intronic
1076868061 10:133178954-133178976 GTCCCTGTGGACAGAGAGGTGGG + Intronic
1078664036 11:13309784-13309806 TTCCATGGGTACTGAGAGGAGGG + Intronic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079614512 11:22474803-22474825 TTCTCTGAGAACACATAGGAAGG + Intergenic
1079814631 11:25039814-25039836 TTCCCTGAGAAGAGAGAGGCAGG + Intronic
1080230347 11:30012853-30012875 ATCCCTGAGAAGAGAGAGCATGG - Exonic
1080949590 11:37015846-37015868 CTACCTGTGAAGACAGAGGAGGG - Intergenic
1083120361 11:60506316-60506338 TTCCCTGTACACAGAGAGCTAGG + Intronic
1085342848 11:75744724-75744746 TTCCCTATGTGCAGAGAGTATGG + Intergenic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1085712792 11:78845080-78845102 CTCCATGGGAGCAGAGAGGAGGG - Intronic
1085745320 11:79110122-79110144 TTTCCTGGCAACAGAGAGGGAGG - Intronic
1086066790 11:82754089-82754111 TTTCCTGTGTAAACAGAGGATGG - Intergenic
1086554014 11:88088101-88088123 TTCCATGTCAGCAGACAGGATGG + Intergenic
1087524320 11:99289457-99289479 TTGCCAGTGAAGAGAGAGAAAGG - Intronic
1089079647 11:115765093-115765115 CTCCCAGTGAACAGGGAGGAGGG - Intergenic
1089498765 11:118920928-118920950 TTCCCAGGGAGGAGAGAGGAGGG + Intronic
1089626693 11:119755495-119755517 CTCCCAGTGTACAGAGAAGATGG - Intergenic
1091047919 11:132341655-132341677 CTCCCTGTGACCAGTGAGCAGGG - Intergenic
1091130817 11:133145821-133145843 TTCGCAGACAACAGAGAGGAAGG + Intronic
1091307250 11:134544138-134544160 TTCCCTGTGAAGAAACAGGAAGG + Intergenic
1091836728 12:3591373-3591395 TTCCCCGTGCACAGAGAAGCAGG + Intronic
1092172637 12:6383558-6383580 TTCCCTGAGGACAGGGAGCAGGG + Intronic
1093211257 12:16312065-16312087 CTCTCTCTGAACAGAGAGCATGG - Intergenic
1093700364 12:22213214-22213236 TTCCTTGAGAACTGAGAGGCTGG - Intronic
1094190181 12:27689991-27690013 CTCCATTTGAGCAGAGAGGAGGG - Intronic
1097015364 12:55982432-55982454 ATTGCTGTGAACAGGGAGGAAGG + Intronic
1099132952 12:78859335-78859357 TTCCCTTTGAAATCAGAGGAAGG - Intergenic
1099650597 12:85422991-85423013 TTCCCTGTAATCAGGGAGGTTGG + Intergenic
1100913474 12:99391189-99391211 TTCTCTGTGAACCAAGAGCAAGG - Intronic
1101142209 12:101808137-101808159 TTCCATGTTCACAGACAGGAAGG + Intronic
1101413718 12:104490711-104490733 CACCCTTTGAAAAGAGAGGATGG + Intronic
1101557066 12:105820323-105820345 CATCCTGTGTACAGAGAGGAAGG + Intergenic
1101647480 12:106644865-106644887 GCCCCTGAGGACAGAGAGGAGGG + Intronic
1102231917 12:111268548-111268570 TTCCCAGTGATGAGAGTGGAAGG + Intronic
1103654268 12:122457737-122457759 ATCCATGGGAACAGGGAGGACGG + Intergenic
1103807161 12:123582629-123582651 TGCATTGTAAACAGAGAGGAAGG + Intergenic
1103921600 12:124402278-124402300 TTGCCTGTGAGCAGGGGGGAGGG - Intronic
1104068568 12:125326059-125326081 CTCCCTGTGAACAGCGTGGTAGG - Intronic
1105728623 13:23189088-23189110 GTCCCTGTGTAGTGAGAGGACGG - Intronic
1105766552 13:23565894-23565916 CTCCCTGAGAACAGAGAGACAGG + Intergenic
1106945949 13:34827929-34827951 ATCCCTGGGAAGAGTGAGGATGG - Intergenic
1108195407 13:47989665-47989687 TTACATGTGAATAGAGAGGGAGG - Intronic
1108264577 13:48693644-48693666 TTCCCTCTGAAAAGAGAGGGAGG + Intronic
1109365758 13:61354507-61354529 TTCCCTGTGTCAAGAGAGGGAGG + Intergenic
1110096130 13:71523549-71523571 TTTACTGTAAAAAGAGAGGAAGG + Intronic
1110339053 13:74367429-74367451 TTCCTTCTAAACAGAGAGCACGG - Intergenic
1111169815 13:84511439-84511461 TTCCCTGTTGACAGACAGCATGG + Intergenic
1111574068 13:90127436-90127458 TTCCCTGTAAAAACAGAGGTGGG + Intergenic
1111965318 13:94856257-94856279 CTCTATGTGGACAGAGAGGAGGG + Intergenic
1112182390 13:97096715-97096737 TTCCAGGTGAAGAGAGAGGAAGG + Intergenic
1112386456 13:98944696-98944718 TACCCTGGGAACAGCGAGGAAGG + Intronic
1112874915 13:104025340-104025362 TTCACTGGGGATAGAGAGGAAGG - Intergenic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1117161493 14:52994590-52994612 TTCCATATGAGCAGAGAAGAGGG - Intergenic
1117339031 14:54778199-54778221 TTCAGTATGAACAAAGAGGAAGG - Intronic
1118336134 14:64854888-64854910 TTCTCTGTGCACAGAGAGGCTGG + Intronic
1118375645 14:65174702-65174724 TTCCCTGGGGCCAGAGAGCAAGG + Intergenic
1118704896 14:68471532-68471554 ATCCCAGTGAACAAAGGGGAGGG - Intronic
1119334436 14:73820753-73820775 TTCCCAGTGAACAGTGACGATGG + Intergenic
1121181087 14:91929449-91929471 TTATCTGTGAAAAGAAAGGATGG - Intronic
1121698782 14:95935562-95935584 TTCCATGTGAGCAGTGAGTATGG - Intergenic
1121982347 14:98465920-98465942 TTCTTTGTGAAGAGAAAGGAAGG + Intergenic
1123088573 14:105731237-105731259 GTCCATGTGGACAGTGAGGAAGG + Intergenic
1123108574 14:105854734-105854756 ACCCCTGTGAACAGAGATGGTGG + Intergenic
1124011870 15:25845473-25845495 GTCCCTGTTACCAGAGAGCAGGG + Intronic
1124080884 15:26494797-26494819 TTCACTGTGTACAGACATGAAGG - Intergenic
1126682607 15:51217381-51217403 TTCCCTGTGATCAGAGTTGTTGG - Intronic
1126737306 15:51743734-51743756 TTCCATGTTCACAGATAGGAAGG - Intronic
1126847210 15:52772020-52772042 TTCACTGTGGGGAGAGAGGAGGG - Intronic
1127994628 15:64146021-64146043 TTCACTGTGAAGAGAGCTGAGGG - Intronic
1128583736 15:68828701-68828723 GTTCCTGGGAACAAAGAGGAAGG + Intronic
1128777715 15:70336271-70336293 TCCCCTGTAGGCAGAGAGGAGGG - Intergenic
1129556394 15:76514551-76514573 TTCTTTGTGATCAGGGAGGAAGG + Intronic
1129644227 15:77415700-77415722 TTTCCAGTGAGCAGAAAGGAAGG - Intronic
1130732756 15:86516216-86516238 TTCCTTGTGGACAAAGATGACGG - Intronic
1130858312 15:87861945-87861967 TTCCCTTAGAACAGAGGGGAAGG - Intronic
1131304079 15:91225854-91225876 TGCTCTGAGAACAGAGAGAAGGG - Exonic
1131342955 15:91619869-91619891 TTTCCTGTGAAGAGAGAGGCTGG + Intergenic
1133680200 16:8114080-8114102 TTCCCTGTGAAGAGAGAGGGTGG + Intergenic
1135001926 16:18783955-18783977 TTCCCTGTGATCCCAGATGAGGG - Intronic
1135829312 16:25759592-25759614 TTCCGTGTTAGAAGAGAGGAGGG + Intronic
1136144342 16:28307109-28307131 GCCGCTGTGAACAGAGAGGCTGG + Intronic
1136178237 16:28533305-28533327 TTCCGTGTGATCCCAGAGGAGGG + Intronic
1136252012 16:29011577-29011599 GTGCTGGTGAACAGAGAGGAAGG - Intergenic
1137685946 16:50386868-50386890 TTGCCCGGGAAAAGAGAGGAAGG - Intergenic
1140576526 16:76176380-76176402 TTTACTGTGAACAGAGTGGCAGG - Intergenic
1141243397 16:82284007-82284029 CTCCCTGTGAACAGAGGGACAGG + Intergenic
1142109353 16:88323039-88323061 TTACCTGTGGACAGTGTGGATGG + Intergenic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1142229453 16:88892985-88893007 TTCACTGTGAACAGGGAGCAAGG + Intronic
1142783786 17:2203687-2203709 TTTCCTGTTAACAGTCAGGAGGG + Intronic
1142878126 17:2864635-2864657 AACCCTGTGAACACAGAGGCTGG + Intronic
1143122289 17:4616146-4616168 TGCCCCGGGAACAGAGATGATGG - Intergenic
1144059407 17:11568959-11568981 TTCCCTGAGAGCAGAGTAGATGG - Intergenic
1144673599 17:17146834-17146856 TTCACTGTGAGCAGTAAGGAAGG - Intronic
1146381802 17:32335703-32335725 TTCCCTGTGAAGAAATAGCATGG - Intronic
1147778247 17:42919480-42919502 TTGCCTCTGGAGAGAGAGGAAGG - Intergenic
1149403806 17:56326552-56326574 GTCCCTGTGGAGAGAGAGGATGG + Intronic
1149858816 17:60108942-60108964 TTCTCTGTGAGCAGAAAAGAGGG - Intergenic
1150378323 17:64700709-64700731 ATCCCTGTGAAAACAGAGTAGGG + Intergenic
1151883606 17:76910291-76910313 CTCCCTCTGAACAGAGAGCCTGG + Intronic
1151963927 17:77421472-77421494 TTCCCTGGGGACCGAGATGAGGG + Intronic
1151995041 17:77603124-77603146 TTCCTTGTGAAGGGAGAGGGAGG + Intergenic
1152265454 17:79291683-79291705 GTCCCTGAGAACAGAGATCAAGG - Intronic
1152743226 17:82027655-82027677 CGCCCTGTGGGCAGAGAGGAGGG - Exonic
1154296984 18:13160287-13160309 TTCACTGTGAACAGAGAAATCGG + Intergenic
1155098169 18:22580083-22580105 TACCCTGTCAGCAGGGAGGAGGG - Intergenic
1155533239 18:26789330-26789352 TTGCCTGTGAAGAGAAAGGAGGG - Intergenic
1155689316 18:28598571-28598593 TTCCCTCTGACCAAACAGGATGG - Intergenic
1155805441 18:30165406-30165428 TTAACTATGAACAGAGAAGATGG + Intergenic
1156045194 18:32870139-32870161 TTTGCTGAGAAGAGAGAGGAGGG - Intergenic
1156637894 18:39053219-39053241 GTCCCATTGAACAGAGAAGATGG + Intergenic
1157203650 18:45680313-45680335 TTCTCTGAAAACAGAGAGAAAGG - Intronic
1157204502 18:45687204-45687226 TGCCCTGTGAGCAGGTAGGATGG + Intergenic
1157535976 18:48457540-48457562 TGCCCTGTGATCTGAGAAGAGGG - Intergenic
1158527215 18:58225754-58225776 TTCCCTGCAAGCAGAGAGGTAGG - Intronic
1158550242 18:58429740-58429762 TAGCCTGTGAAAAGAGAGGGAGG - Intergenic
1158710366 18:59831869-59831891 TTCCCTCAGGCCAGAGAGGATGG + Intergenic
1159662394 18:71114789-71114811 TTTCCTGAGAACATACAGGAGGG - Intergenic
1160025769 18:75214663-75214685 TTCACAGTGATGAGAGAGGAAGG + Intronic
1160431418 18:78815597-78815619 TTCTAGCTGAACAGAGAGGAAGG + Intergenic
1161568550 19:5017095-5017117 TTCCCTGTGCAGAGGGAGGAAGG + Intronic
1161591246 19:5130072-5130094 GTGCCTGTGAAGGGAGAGGAAGG - Intronic
1161636644 19:5393420-5393442 TTCCCAGGCAAAAGAGAGGAGGG - Intergenic
1161777751 19:6273033-6273055 TTCCCTGGGAAAAGAGGGCAGGG + Intronic
1161887920 19:7011403-7011425 ATCACTGTGGACAAAGAGGATGG - Intergenic
1162834567 19:13307947-13307969 TTTCCTGGGGACAGAGATGATGG - Intronic
1164411219 19:28007215-28007237 TTCCCTGTGATGATACAGGATGG - Intergenic
1166255817 19:41603734-41603756 TCCCCAGTGAACTGAAAGGATGG - Intronic
1167514620 19:49915889-49915911 TTGCCTCCGAACACAGAGGAAGG + Intronic
925067284 2:938295-938317 TGCCCTGTGAACTGGGAGGTTGG - Intergenic
925177233 2:1794219-1794241 TTCCCTGAGCACAGACAGGAGGG - Intronic
925392252 2:3503892-3503914 TGCCGAGTGAACAGAGAAGAGGG + Intronic
925416735 2:3675503-3675525 TTATCTGTGAAGAGAGAGGTGGG + Intronic
926096894 2:10087193-10087215 TTCCCTGGCAAGAGAGAGGTTGG - Intergenic
926702642 2:15813928-15813950 TTCCTTGAGACAAGAGAGGAAGG - Intergenic
927004842 2:18837216-18837238 GTCTATGAGAACAGAGAGGAAGG - Intergenic
927046387 2:19283090-19283112 GTCCCTGGCAATAGAGAGGATGG - Intergenic
927494070 2:23540806-23540828 CTCCCCATGACCAGAGAGGACGG + Intronic
927783302 2:25955827-25955849 GGCCCTGGGAACTGAGAGGAGGG - Intronic
928126098 2:28617741-28617763 CTTCCTGTGTACAGAGTGGAAGG + Exonic
929124764 2:38513077-38513099 ATCCCTGTGTAGAGAGAGGGAGG + Intergenic
929788933 2:45010022-45010044 TGCCCGGTGAACAGAGAGCCTGG - Intergenic
931062385 2:58545779-58545801 TACTCTGGGAACAGAAAGGAAGG - Intergenic
932753537 2:74388609-74388631 TGCTCTGTGAGCACAGAGGAGGG - Intronic
934057472 2:88263736-88263758 GTCCCTTTAAAAAGAGAGGAGGG - Intergenic
935091759 2:99901439-99901461 TCGGCTGTGAAGAGAGAGGAGGG - Intronic
936615971 2:114048155-114048177 TTCCCTATGTGCAGGGAGGAGGG - Intergenic
937152444 2:119695340-119695362 TGCCATGGGAACAGAGGGGAGGG - Intergenic
937483571 2:122290018-122290040 TTCCCTCTGGATAGAGAGAAGGG - Intergenic
937895219 2:126972621-126972643 TTCCCTGTGGGCGGAGGGGAGGG - Intergenic
938154136 2:128915409-128915431 TTCCCTGTGATAAGAGAGAAGGG - Intergenic
941903728 2:170701695-170701717 TGGACTGTGCACAGAGAGGATGG + Intergenic
942571303 2:177317313-177317335 TTCCTTGTGAACAGGCTGGAGGG - Intronic
942708398 2:178802819-178802841 GTCCCTGTAACCACAGAGGAGGG - Intronic
945383833 2:209173478-209173500 ATCCCTCTGAAGAGAGGGGAAGG - Intergenic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
948073654 2:235148021-235148043 TTGCCTGGGAGCAGAGGGGAAGG - Intergenic
1171824612 20:29883676-29883698 CTCACTGTGGCCAGAGAGGAAGG - Intergenic
1172024591 20:31939194-31939216 GGCCCTGTTAGCAGAGAGGAGGG + Exonic
1172063529 20:32203564-32203586 TTCCATGTGAAGAGAGAAAAGGG + Intronic
1172142112 20:32730251-32730273 CTCCCTGTGAACAGTGTGTATGG + Intronic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1172884270 20:38220993-38221015 TTCCCTCTGAAGGCAGAGGAGGG - Intronic
1173296596 20:41764660-41764682 TTCTCTGAGACCAGAGGGGATGG + Intergenic
1174097045 20:48097759-48097781 TGCCCAGTGCACAGAGAGGCTGG - Intergenic
1174254256 20:49242575-49242597 TTGGCTGTGCACAGAGAGAATGG - Exonic
1174713227 20:52728896-52728918 TTCATTGTGGCCAGAGAGGAAGG + Intergenic
1174860756 20:54088916-54088938 TTCCACATGAGCAGAGAGGAGGG - Intergenic
1177864153 21:26492883-26492905 TTCTATGAGATCAGAGAGGACGG + Intronic
1178603952 21:34018905-34018927 ATCCCTGGGAACAGGAAGGAAGG - Intergenic
1178819527 21:35962530-35962552 TTCCCTGTGCAAAGAGAAGGAGG - Intronic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1179395596 21:41037388-41037410 TTCCCTGTGAACAGGCAGAAGGG - Intergenic
1179466570 21:41579705-41579727 TTTTCTGTAAGCAGAGAGGAGGG - Intergenic
1180253352 21:46605111-46605133 TTCCCTCTGCCCAGGGAGGATGG + Exonic
1180610716 22:17095975-17095997 TTCCCTCTCAAGAGAGAGGAGGG + Intronic
1181755944 22:25024905-25024927 TGCTCTGTGAACAGGTAGGAGGG + Intronic
1181806677 22:25378918-25378940 TGCCCTGTGCACAGAGAGGCAGG - Intronic
1181990019 22:26830281-26830303 TTACCTGTGCTCACAGAGGAAGG + Intergenic
1183523168 22:38308400-38308422 TTCCCCATGAGCAGAGAGGCAGG + Intronic
1183747612 22:39700621-39700643 TCTCCTGTGAACAGTGATGAGGG + Intergenic
1183829313 22:40409508-40409530 CTCCCTGCGAAGAGAGAGGTGGG + Exonic
949185772 3:1189840-1189862 TTGCCTGTAAAAAGAGGGGATGG - Intronic
950727575 3:14927053-14927075 TTCCCAGGGATCACAGAGGATGG + Intronic
951484434 3:23196064-23196086 ATACCTGTGAAAAGAGAGAAAGG - Intergenic
951497689 3:23349091-23349113 TTTCTTGTGAACAGAGAGATTGG + Intronic
952547664 3:34438304-34438326 TTACCTGTAAAATGAGAGGAAGG + Intergenic
953123356 3:40067568-40067590 TTTTCTGTGAGCACAGAGGAGGG + Intronic
953236329 3:41110764-41110786 TTCCCTAAGAAGAGAGAGGGAGG + Intergenic
954842171 3:53521480-53521502 GGCACTGTGATCAGAGAGGAGGG + Intronic
954872723 3:53780007-53780029 ATCTCTGTAAACAGAAAGGAAGG - Exonic
955488114 3:59455269-59455291 TTCCCTCTGAACAGGCAGGAAGG + Intergenic
956887711 3:73577481-73577503 CTCCCTGGGGACAGAGAGCAGGG - Intronic
958049987 3:88333102-88333124 TTTTCTGTGATCAGATAGGATGG + Intergenic
959731549 3:109609092-109609114 TTTCCTGGGAACTGAGAGCAAGG - Intergenic
959826798 3:110806881-110806903 TTCCCTGAGAGCAGGGAAGAGGG - Intergenic
960998439 3:123354630-123354652 ATCTGTGTGAAAAGAGAGGAAGG + Intronic
962293926 3:134162919-134162941 TTCCCTGTGTACAAAGAGTCAGG - Intronic
962595942 3:136943533-136943555 TTTCCTTGGAATAGAGAGGAAGG + Intronic
963850689 3:150207559-150207581 TTCCCTGTAAAATCAGAGGATGG - Intergenic
964428809 3:156582120-156582142 TTTCCTGTCATCAGAGATGAGGG + Intergenic
965635817 3:170779155-170779177 GTCCCTGTGAACAGAAAATATGG + Intronic
965897182 3:173592927-173592949 ATCACTGTGAACTGAGAGAAGGG - Intronic
966356345 3:179083287-179083309 GTCCCTCTGACCAGAGATGATGG - Intergenic
966945944 3:184777183-184777205 TGCCCTGGGTTCAGAGAGGAAGG - Intergenic
967195262 3:187020670-187020692 TTTTCTGTTAACAGAGATGAAGG - Intronic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
968189088 3:196654508-196654530 AGCCCTGTGGACAGAGAGCAGGG - Exonic
970074581 4:12203078-12203100 TGCCATGGGAACACAGAGGAAGG + Intergenic
970427614 4:15959926-15959948 TTCCATGTGAAGACAGAGGCAGG + Intergenic
971508320 4:27391095-27391117 TACCCTGTGAACAGCCAGGATGG - Intergenic
976913668 4:90342453-90342475 TTCTCTGTGAAAAGAAAGGTAGG - Intronic
978556793 4:109989717-109989739 TTTCCTTTGAAGAGAAAGGAAGG + Intronic
979007928 4:115326529-115326551 CTCACTGTGAACAGATAGCACGG - Intergenic
980320648 4:131268668-131268690 TTCCATGTGAAGAGATATGAGGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982069775 4:151685233-151685255 TGCAGTGGGAACAGAGAGGAGGG - Intronic
982295963 4:153829459-153829481 TACCCTGTTCACAGAGAGGTAGG - Intergenic
983926045 4:173403436-173403458 TTCCCTGGGCATAGAGAGTAAGG + Intronic
984653656 4:182294569-182294591 TTCTCTGTGAAGAGATAGAAAGG + Intronic
984713254 4:182903535-182903557 CACCCTGTGCCCAGAGAGGAGGG + Intronic
984731049 4:183068594-183068616 TTCCCTGGGATCTGAGATGAAGG - Intergenic
985530641 5:431852-431874 TGCCCAGAGGACAGAGAGGAGGG + Intronic
986032824 5:3909673-3909695 TTCCCGGCCAACACAGAGGAGGG + Intergenic
987069919 5:14326508-14326530 CACCCTCTGAACAGAGAGGAAGG + Intronic
987130645 5:14856946-14856968 TTCCCTGTGAACATATGGGTGGG - Intronic
987514920 5:18892807-18892829 TTCCCTGTGAGCAGGGAGCTGGG + Intergenic
988558465 5:32259307-32259329 TTCCCTGTAAACGCATAGGATGG - Intronic
989103975 5:37843598-37843620 TTCCTTGAGAACAGAGAAGCTGG - Intergenic
995047153 5:107664747-107664769 TTCCCTAAGCACAGTGAGGAAGG - Intronic
996328012 5:122297939-122297961 TTCCTTGTTAACAAAGAGGGAGG + Intergenic
996590970 5:125147431-125147453 TTCCCTGTGGCCGGGGAGGAAGG - Intergenic
997282359 5:132656849-132656871 TTCCCTGTGGGAAGAGAGGGTGG + Intronic
997783899 5:136688396-136688418 TTCGCTGTGATCTGAGAGTATGG - Intergenic
997998595 5:138606307-138606329 CTCCCTGAGGACAGAGAGGTTGG - Intergenic
998327864 5:141298101-141298123 TTCTCTGTCAGCAGAGAGGCGGG + Intergenic
999069297 5:148726549-148726571 TTCCCTGTGAGTACAGAGCATGG - Intergenic
999458777 5:151740046-151740068 TTCCCTCTGCACACAGAGCAAGG - Intergenic
999636015 5:153623254-153623276 TTCCCTGGGTTCAGAGAGGAGGG + Intronic
999961712 5:156763038-156763060 ATGCCTGGGAACAGGGAGGATGG + Intronic
1000013346 5:157254490-157254512 TTCCCTGATATAAGAGAGGATGG + Exonic
1000702883 5:164474780-164474802 TTGGCTTTGAACACAGAGGAAGG + Intergenic
1001351472 5:170971400-170971422 TTCCATGTCTACAGAAAGGAAGG - Intronic
1004251716 6:14028428-14028450 TTCACTGTGACCACAGAGAATGG + Intergenic
1004876681 6:19962684-19962706 TACCCTGTGAAGATGGAGGAAGG + Intergenic
1006665385 6:35689283-35689305 GGCCCTGTGGACAGATAGGAGGG - Intronic
1007297621 6:40838426-40838448 TTTCCTGTGCTCAGAAAGGAAGG + Intergenic
1007355244 6:41310302-41310324 TTCCCAGTGACCAGAGAGCATGG - Intergenic
1007402397 6:41610843-41610865 GTGGCTGTGAACAGAGAGGAAGG + Intergenic
1007687620 6:43676382-43676404 TTCCCTCTGAAGTGCGAGGAAGG + Intronic
1007987223 6:46218864-46218886 CTCCCTGAGGACAGAGAAGAAGG - Intergenic
1009978682 6:70701034-70701056 TTCCGTGTGAGGAGAGAAGAGGG - Intronic
1010117119 6:72326954-72326976 TTCCCTTTGATGACAGAGGAAGG + Intronic
1010610453 6:77948520-77948542 CACCCTGTGAACAGAAAGTACGG + Intergenic
1010872288 6:81058458-81058480 CTACCTGTGCACTGAGAGGACGG - Intergenic
1011453021 6:87515636-87515658 TTCCCTCTGTACAGTGAGGTGGG + Intronic
1012957638 6:105588352-105588374 TTCTCTGTGAAGAGTCAGGAAGG - Intergenic
1013356527 6:109350248-109350270 TTCCCTGTGCAGGGAGAGGAGGG + Intergenic
1013604419 6:111734563-111734585 CTCCCTGTGATGAGGGAGGAGGG - Intronic
1014893303 6:126869535-126869557 ATCTCAGTGAACAGAGTGGAAGG - Intergenic
1015101119 6:129481893-129481915 TTCTTTGTGTCCAGAGAGGATGG - Intronic
1015804102 6:137091400-137091422 TTGCCTGTGGACAGAGAGGAGGG + Intergenic
1015983718 6:138864832-138864854 TTACCTTTGAAAACAGAGGATGG + Intronic
1018398058 6:163395991-163396013 TTCACTGAGAACAGAAAGGAAGG + Intergenic
1018716354 6:166535657-166535679 TTCCCTGCGAGCTTAGAGGAGGG - Intronic
1019281384 7:202176-202198 TCCCATGTGCATAGAGAGGACGG + Intronic
1019281467 7:202539-202561 TCCCGTGTGCATAGAGAGGACGG + Intronic
1019639084 7:2093469-2093491 TTCCCTGGGAAGAGGGACGACGG + Intronic
1019677540 7:2323561-2323583 TGCCATGTTAACAGAGAGAAAGG + Intronic
1020441086 7:8217243-8217265 TTCCCTCTGAAGAGAAAGCAGGG - Intronic
1021853952 7:24834932-24834954 TTCCCTGTGAATAAAGTCGATGG - Intronic
1021873294 7:25025352-25025374 TTCACTCTGACCAGAAAGGAAGG - Intergenic
1022525213 7:31032757-31032779 TTTGCTGTGAACAGCGAGGTGGG + Intergenic
1023081567 7:36531721-36531743 TTCCCTGAGAGAAGGGAGGAAGG + Intronic
1024249632 7:47496370-47496392 TCCCCTGTGACCAGAGCTGATGG + Intronic
1024611275 7:51066346-51066368 TTCCCTGTGTCCACAGAGGAAGG - Intronic
1025865731 7:65378905-65378927 TTCCTGGAGAACAGAAAGGATGG + Intronic
1026227809 7:68457999-68458021 TTCCCTCTTTACAGAGGGGATGG + Intergenic
1027435659 7:78161928-78161950 TTCCATTTGAACAGAAAGAAAGG - Intronic
1027697353 7:81428570-81428592 TCATCTGTGAACAAAGAGGAGGG + Intergenic
1028101150 7:86822552-86822574 TTGCATGTGAGCAAAGAGGAAGG + Intronic
1028721226 7:94034168-94034190 TTCCATGTGGCCAGAGAAGATGG + Intergenic
1029805378 7:102990621-102990643 GACTCTGGGAACAGAGAGGAAGG + Intronic
1032773175 7:135080481-135080503 TTCCCAGGGAGCAGAGAGAAAGG + Intronic
1033889942 7:145999796-145999818 TTCCCTGTTAACAAGGAGCATGG - Intergenic
1034050379 7:147977847-147977869 TTCCCTGTGATCCAGGAGGAAGG + Exonic
1034731626 7:153392202-153392224 TACCATTAGAACAGAGAGGAAGG + Intergenic
1035775947 8:2188417-2188439 TTCTCTGTGAACACAGTGCAGGG - Intergenic
1035828856 8:2673060-2673082 GTCCGTGTGTACAGTGAGGAAGG + Intergenic
1036477850 8:9109881-9109903 TTCCCAGGAAACAGAGAGCATGG - Intronic
1036691399 8:10946962-10946984 TTGCGTGGGGACAGAGAGGAAGG + Intronic
1037281328 8:17246257-17246279 TTCCCAGAGAAACGAGAGGACGG + Intronic
1038335277 8:26640965-26640987 ATTCCTGTGCACAGAGAGAAGGG + Intronic
1039271419 8:35884820-35884842 TTCTCTGAAAACAGAGGGGAAGG + Intergenic
1040999007 8:53431179-53431201 ATCCCTGTGACCAGAGAGACTGG + Intergenic
1042123495 8:65513182-65513204 TTCCCTGAAAACAGCGATGAGGG + Intergenic
1042602806 8:70515098-70515120 TTTCCTTTGAAAAGAGGGGAGGG - Intergenic
1042629801 8:70804293-70804315 TTCTCTGTGAACTCAGTGGAAGG - Intergenic
1043136306 8:76530280-76530302 TTCCCTCCCAACAGAAAGGAGGG + Intergenic
1043447187 8:80330649-80330671 TTCACAGATAACAGAGAGGAGGG - Intergenic
1044517223 8:93153650-93153672 TTCCCTGTAGACAGGCAGGACGG - Intronic
1044534174 8:93340525-93340547 TTCTCTGAAAACAGTGAGGAAGG - Intergenic
1045299857 8:100901690-100901712 TAGCTTATGAACAGAGAGGAGGG - Intergenic
1046508002 8:115161011-115161033 TTCAGTGTGAACATAGAGAAAGG - Intergenic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047773352 8:128048779-128048801 TGCCCTTTGAAGAAAGAGGAAGG + Intergenic
1048732662 8:137461165-137461187 TTGTCTGTGAACAGAGCTGATGG + Intergenic
1049386920 8:142347480-142347502 GTCTCTGTGCAGAGAGAGGATGG - Intronic
1049910839 9:266198-266220 TTCCTTGTTAGCAAAGAGGAAGG - Intronic
1049983411 9:925490-925512 TTCACACTTAACAGAGAGGATGG + Intronic
1050498119 9:6265911-6265933 TTCCATGTGAACAAGGAGCATGG - Intergenic
1052002803 9:23307283-23307305 TTCTCTCTGAACACAGAGGCAGG + Intergenic
1052275622 9:26672799-26672821 TGCCCTGGGAACATAGAGGCTGG - Intergenic
1052871982 9:33516070-33516092 TTCACTGTGAACGGAGAGACGGG + Intergenic
1052944715 9:34159033-34159055 TTCCAAGTGAACATATAGGAAGG - Intergenic
1057685622 9:97231879-97231901 TTCACTGTGAACAGAGAAATGGG - Intergenic
1058297470 9:103327018-103327040 TTCTCTGTAAAGAGAGATGAGGG + Intergenic
1059635038 9:116162052-116162074 TTGCAAGTGTACAGAGAGGAGGG - Intronic
1059902340 9:118942035-118942057 TTTCCTGAGAACCAAGAGGACGG + Intergenic
1060103674 9:120860600-120860622 TTTCCTGAGGACACAGAGGAGGG - Intronic
1060115287 9:120935519-120935541 TTCCCTGTGAAAGGAGAAGCAGG - Intergenic
1060230665 9:121822876-121822898 ATCCCTGTGAACAAAGAGACTGG + Exonic
1060317875 9:122529897-122529919 TACCCTGGTAACAGAGAAGAAGG + Intergenic
1060342031 9:122786032-122786054 TTACCTGTGCCCAGTGAGGATGG - Intergenic
1060604064 9:124898692-124898714 TTCCCTGGGCACAGGGAGCATGG + Intronic
1061374749 9:130217310-130217332 TTCCCTGGGAACAGAGACTGAGG + Intronic
1061927706 9:133814127-133814149 TCCCCTGGGAACAGACATGAAGG + Intronic
1186193003 X:7084363-7084385 ATTCCTAAGAACAGAGAGGATGG - Intronic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1189185717 X:39053019-39053041 TTCCCAGTGAGAAGGGAGGATGG + Intergenic
1190592240 X:52015866-52015888 TTACCTGGGAACAAAAAGGAAGG - Intergenic
1190990926 X:55549443-55549465 TTCATTTTGAACACAGAGGATGG - Intergenic
1191108615 X:56788242-56788264 TCCCATGTGAATAAAGAGGAAGG - Intergenic
1196038849 X:111178675-111178697 ATCTCTGTGGACAGAGAGGAGGG + Intronic
1198455741 X:136815983-136816005 TTCCCTGTAAAGGGAGATGAAGG - Intergenic
1199005068 X:142686256-142686278 TTCCCTGTGAACCCAGAGGTGGG + Intergenic
1200072693 X:153536904-153536926 TCTCCTGGGAAGAGAGAGGATGG + Intronic
1201905205 Y:19080127-19080149 TTGCCTGAGAGCACAGAGGAAGG + Intergenic
1202260673 Y:22967097-22967119 TCACCTGTAAACAGAGAGCAAGG - Intergenic
1202413660 Y:24600838-24600860 TCACCTGTAAACAGAGAGCAAGG - Intergenic
1202457125 Y:25069248-25069270 TCACCTGTAAACAGAGAGCAAGG + Intergenic