ID: 1142133638

View in Genome Browser
Species Human (GRCh38)
Location 16:88442038-88442060
Sequence GTCACTTGTCTCCTGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133638_1142133640 -9 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133640 16:88442052-88442074 ACAAGTGACCCTCTCCAGTGAGG No data
1142133638_1142133652 30 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133652 16:88442091-88442113 CCCTGACTGGGCAGATGAGGAGG No data
1142133638_1142133643 -4 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133643 16:88442057-88442079 TGACCCTCTCCAGTGAGGGTGGG No data
1142133638_1142133649 27 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133649 16:88442088-88442110 GACCCCTGACTGGGCAGATGAGG No data
1142133638_1142133647 17 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133638_1142133648 18 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133648 16:88442079-88442101 GTCAGAGTAGACCCCTGACTGGG No data
1142133638_1142133641 -8 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133641 16:88442053-88442075 CAAGTGACCCTCTCCAGTGAGGG No data
1142133638_1142133642 -5 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133642 16:88442056-88442078 GTGACCCTCTCCAGTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133638 Original CRISPR GTCACTTGTCTCCTGGACAC TGG (reversed) Intergenic
No off target data available for this crispr