ID: 1142133639

View in Genome Browser
Species Human (GRCh38)
Location 16:88442045-88442067
Sequence GGAGAGGGTCACTTGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133639_1142133647 10 Left 1142133639 16:88442045-88442067 CCAGGAGACAAGTGACCCTCTCC No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133639_1142133652 23 Left 1142133639 16:88442045-88442067 CCAGGAGACAAGTGACCCTCTCC No data
Right 1142133652 16:88442091-88442113 CCCTGACTGGGCAGATGAGGAGG No data
1142133639_1142133648 11 Left 1142133639 16:88442045-88442067 CCAGGAGACAAGTGACCCTCTCC No data
Right 1142133648 16:88442079-88442101 GTCAGAGTAGACCCCTGACTGGG No data
1142133639_1142133649 20 Left 1142133639 16:88442045-88442067 CCAGGAGACAAGTGACCCTCTCC No data
Right 1142133649 16:88442088-88442110 GACCCCTGACTGGGCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133639 Original CRISPR GGAGAGGGTCACTTGTCTCC TGG (reversed) Intergenic
No off target data available for this crispr