ID: 1142133644

View in Genome Browser
Species Human (GRCh38)
Location 16:88442060-88442082
Sequence TGACCCACCCTCACTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133644_1142133647 -5 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133644_1142133654 19 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133654 16:88442102-88442124 CAGATGAGGAGGCTGCTCAGAGG No data
1142133644_1142133652 8 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133652 16:88442091-88442113 CCCTGACTGGGCAGATGAGGAGG No data
1142133644_1142133649 5 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133649 16:88442088-88442110 GACCCCTGACTGGGCAGATGAGG No data
1142133644_1142133648 -4 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133648 16:88442079-88442101 GTCAGAGTAGACCCCTGACTGGG No data
1142133644_1142133655 22 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133655 16:88442105-88442127 ATGAGGAGGCTGCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133644 Original CRISPR TGACCCACCCTCACTGGAGA GGG (reversed) Intergenic
No off target data available for this crispr