ID: 1142133647

View in Genome Browser
Species Human (GRCh38)
Location 16:88442078-88442100
Sequence GGTCAGAGTAGACCCCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133635_1142133647 28 Left 1142133635 16:88442027-88442049 CCTCAAAGATCCCAGTGTCCAGG No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133637_1142133647 18 Left 1142133637 16:88442037-88442059 CCCAGTGTCCAGGAGACAAGTGA No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133644_1142133647 -5 Left 1142133644 16:88442060-88442082 CCCTCTCCAGTGAGGGTGGGTCA No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133639_1142133647 10 Left 1142133639 16:88442045-88442067 CCAGGAGACAAGTGACCCTCTCC No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133633_1142133647 30 Left 1142133633 16:88442025-88442047 CCCCTCAAAGATCCCAGTGTCCA No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133645_1142133647 -6 Left 1142133645 16:88442061-88442083 CCTCTCCAGTGAGGGTGGGTCAG No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133638_1142133647 17 Left 1142133638 16:88442038-88442060 CCAGTGTCCAGGAGACAAGTGAC No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data
1142133634_1142133647 29 Left 1142133634 16:88442026-88442048 CCCTCAAAGATCCCAGTGTCCAG No data
Right 1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133647 Original CRISPR GGTCAGAGTAGACCCCTGAC TGG Intergenic
No off target data available for this crispr