ID: 1142133798

View in Genome Browser
Species Human (GRCh38)
Location 16:88442615-88442637
Sequence CGCCTGGGGGCTGCGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133798_1142133809 4 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133809 16:88442642-88442664 CTTCTGAACAGGTGCTGGTCTGG No data
1142133798_1142133807 -1 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133807 16:88442637-88442659 GGGGCCTTCTGAACAGGTGCTGG No data
1142133798_1142133811 11 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133811 16:88442649-88442671 ACAGGTGCTGGTCTGGCACAGGG No data
1142133798_1142133812 22 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133812 16:88442660-88442682 TCTGGCACAGGGACTATACCTGG No data
1142133798_1142133813 25 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133813 16:88442663-88442685 GGCACAGGGACTATACCTGGCGG No data
1142133798_1142133815 29 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133815 16:88442667-88442689 CAGGGACTATACCTGGCGGGTGG No data
1142133798_1142133806 -7 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133806 16:88442631-88442653 CCAGGCGGGGCCTTCTGAACAGG No data
1142133798_1142133810 10 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133810 16:88442648-88442670 AACAGGTGCTGGTCTGGCACAGG No data
1142133798_1142133814 26 Left 1142133798 16:88442615-88442637 CCAGCAGACGCAGCCCCCAGGCG No data
Right 1142133814 16:88442664-88442686 GCACAGGGACTATACCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133798 Original CRISPR CGCCTGGGGGCTGCGTCTGC TGG (reversed) Intergenic
No off target data available for this crispr