ID: 1142133889

View in Genome Browser
Species Human (GRCh38)
Location 16:88442952-88442974
Sequence TGGGGTGCCCTGGATGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133889_1142133904 30 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133904 16:88443005-88443027 CACTCGCTCCCACCAGCCTCGGG No data
1142133889_1142133893 -10 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133893 16:88442965-88442987 GGGCACCCCACTCGGGTCAGCGG No data
1142133889_1142133896 -4 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133896 16:88442971-88442993 CCCACTCGGGTCAGCGGCTCTGG No data
1142133889_1142133903 29 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133903 16:88443004-88443026 GCACTCGCTCCCACCAGCCTCGG No data
1142133889_1142133898 -3 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133898 16:88442972-88442994 CCACTCGGGTCAGCGGCTCTGGG No data
1142133889_1142133902 7 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133902 16:88442982-88443004 CAGCGGCTCTGGGACGGGCTGGG No data
1142133889_1142133900 2 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG No data
1142133889_1142133901 6 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133901 16:88442981-88443003 TCAGCGGCTCTGGGACGGGCTGG No data
1142133889_1142133899 1 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133899 16:88442976-88442998 TCGGGTCAGCGGCTCTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133889 Original CRISPR TGGGGTGCCCTGGATGCTGC CGG (reversed) Intergenic
No off target data available for this crispr