ID: 1142133900

View in Genome Browser
Species Human (GRCh38)
Location 16:88442977-88442999
Sequence CGGGTCAGCGGCTCTGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133887_1142133900 7 Left 1142133887 16:88442947-88442969 CCCGGCCGGCAGCATCCAGGGCA No data
Right 1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG No data
1142133886_1142133900 8 Left 1142133886 16:88442946-88442968 CCCCGGCCGGCAGCATCCAGGGC No data
Right 1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG No data
1142133888_1142133900 6 Left 1142133888 16:88442948-88442970 CCGGCCGGCAGCATCCAGGGCAC No data
Right 1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG No data
1142133892_1142133900 -8 Left 1142133892 16:88442962-88442984 CCAGGGCACCCCACTCGGGTCAG No data
Right 1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG No data
1142133889_1142133900 2 Left 1142133889 16:88442952-88442974 CCGGCAGCATCCAGGGCACCCCA No data
Right 1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133900 Original CRISPR CGGGTCAGCGGCTCTGGGAC GGG Intergenic
No off target data available for this crispr