ID: 1142133941

View in Genome Browser
Species Human (GRCh38)
Location 16:88443148-88443170
Sequence CTGGAGACCCAGGATGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142133932_1142133941 7 Left 1142133932 16:88443118-88443140 CCTCCTGTGGGGCCTGAAACCAC No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133936_1142133941 -5 Left 1142133936 16:88443130-88443152 CCTGAAACCACCGTTTGGCTGGA No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133923_1142133941 30 Left 1142133923 16:88443095-88443117 CCTGCCCCTGTCCACTCACCGCT No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133931_1142133941 12 Left 1142133931 16:88443113-88443135 CCGCTCCTCCTGTGGGGCCTGAA No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133924_1142133941 26 Left 1142133924 16:88443099-88443121 CCCCTGTCCACTCACCGCTCCTC No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133926_1142133941 24 Left 1142133926 16:88443101-88443123 CCTGTCCACTCACCGCTCCTCCT No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133933_1142133941 4 Left 1142133933 16:88443121-88443143 CCTGTGGGGCCTGAAACCACCGT No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133928_1142133941 19 Left 1142133928 16:88443106-88443128 CCACTCACCGCTCCTCCTGTGGG No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data
1142133925_1142133941 25 Left 1142133925 16:88443100-88443122 CCCTGTCCACTCACCGCTCCTCC No data
Right 1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142133941 Original CRISPR CTGGAGACCCAGGATGTGGA CGG Intergenic
No off target data available for this crispr