ID: 1142134010

View in Genome Browser
Species Human (GRCh38)
Location 16:88443424-88443446
Sequence CGTGCATGCGTGTGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142134010_1142134014 11 Left 1142134010 16:88443424-88443446 CCACAGGCACACACGCATGCACG No data
Right 1142134014 16:88443458-88443480 ACACGCCTACTCGGCCCCCGGGG No data
1142134010_1142134016 21 Left 1142134010 16:88443424-88443446 CCACAGGCACACACGCATGCACG No data
Right 1142134016 16:88443468-88443490 TCGGCCCCCGGGGTGCACTCAGG No data
1142134010_1142134013 10 Left 1142134010 16:88443424-88443446 CCACAGGCACACACGCATGCACG No data
Right 1142134013 16:88443457-88443479 CACACGCCTACTCGGCCCCCGGG No data
1142134010_1142134012 9 Left 1142134010 16:88443424-88443446 CCACAGGCACACACGCATGCACG No data
Right 1142134012 16:88443456-88443478 ACACACGCCTACTCGGCCCCCGG No data
1142134010_1142134011 2 Left 1142134010 16:88443424-88443446 CCACAGGCACACACGCATGCACG No data
Right 1142134011 16:88443449-88443471 CGCACGCACACACGCCTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142134010 Original CRISPR CGTGCATGCGTGTGTGCCTG TGG (reversed) Intergenic