ID: 1142135229

View in Genome Browser
Species Human (GRCh38)
Location 16:88448958-88448980
Sequence AGCCACAGCAGACACTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142135229_1142135232 -9 Left 1142135229 16:88448958-88448980 CCTCCGCAGTGTCTGCTGTGGCT No data
Right 1142135232 16:88448972-88448994 GCTGTGGCTGCTGCTGTAGGAGG No data
1142135229_1142135235 13 Left 1142135229 16:88448958-88448980 CCTCCGCAGTGTCTGCTGTGGCT No data
Right 1142135235 16:88448994-88449016 GGCAGCGCTGACTGCGGAAGAGG No data
1142135229_1142135236 23 Left 1142135229 16:88448958-88448980 CCTCCGCAGTGTCTGCTGTGGCT No data
Right 1142135236 16:88449004-88449026 ACTGCGGAAGAGGAGACAGCTGG No data
1142135229_1142135234 7 Left 1142135229 16:88448958-88448980 CCTCCGCAGTGTCTGCTGTGGCT No data
Right 1142135234 16:88448988-88449010 TAGGAGGGCAGCGCTGACTGCGG No data
1142135229_1142135233 -8 Left 1142135229 16:88448958-88448980 CCTCCGCAGTGTCTGCTGTGGCT No data
Right 1142135233 16:88448973-88448995 CTGTGGCTGCTGCTGTAGGAGGG No data
1142135229_1142135237 24 Left 1142135229 16:88448958-88448980 CCTCCGCAGTGTCTGCTGTGGCT No data
Right 1142135237 16:88449005-88449027 CTGCGGAAGAGGAGACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142135229 Original CRISPR AGCCACAGCAGACACTGCGG AGG (reversed) Intergenic
No off target data available for this crispr