ID: 1142136155

View in Genome Browser
Species Human (GRCh38)
Location 16:88452955-88452977
Sequence GGCGGGGCCGAACCAGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142136139_1142136155 19 Left 1142136139 16:88452913-88452935 CCAAAGAGGAGTGGGGGAGGCTA No data
Right 1142136155 16:88452955-88452977 GGCGGGGCCGAACCAGGAAGGGG No data
1142136133_1142136155 27 Left 1142136133 16:88452905-88452927 CCTCCGGGCCAAAGAGGAGTGGG No data
Right 1142136155 16:88452955-88452977 GGCGGGGCCGAACCAGGAAGGGG No data
1142136137_1142136155 24 Left 1142136137 16:88452908-88452930 CCGGGCCAAAGAGGAGTGGGGGA No data
Right 1142136155 16:88452955-88452977 GGCGGGGCCGAACCAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142136155 Original CRISPR GGCGGGGCCGAACCAGGAAG GGG Intergenic