ID: 1142136682

View in Genome Browser
Species Human (GRCh38)
Location 16:88454745-88454767
Sequence GACGCAGGTCTTCCTCCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142136666_1142136682 28 Left 1142136666 16:88454694-88454716 CCCTCCCCACCCTATGCCAATAA 0: 1
1: 1
2: 3
3: 52
4: 370
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136676_1142136682 -5 Left 1142136676 16:88454727-88454749 CCTCACAGTTAGGGCCCAGACGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136667_1142136682 27 Left 1142136667 16:88454695-88454717 CCTCCCCACCCTATGCCAATAAT 0: 1
1: 0
2: 2
3: 20
4: 185
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136672_1142136682 18 Left 1142136672 16:88454704-88454726 CCTATGCCAATAATAACTTTGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136669_1142136682 23 Left 1142136669 16:88454699-88454721 CCCACCCTATGCCAATAATAACT 0: 1
1: 0
2: 2
3: 14
4: 210
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136668_1142136682 24 Left 1142136668 16:88454698-88454720 CCCCACCCTATGCCAATAATAAC 0: 1
1: 0
2: 2
3: 32
4: 454
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136670_1142136682 22 Left 1142136670 16:88454700-88454722 CCACCCTATGCCAATAATAACTT 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136671_1142136682 19 Left 1142136671 16:88454703-88454725 CCCTATGCCAATAATAACTTTGC 0: 1
1: 0
2: 2
3: 16
4: 138
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1142136673_1142136682 12 Left 1142136673 16:88454710-88454732 CCAATAATAACTTTGCGCCTCAC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142136682 Original CRISPR GACGCAGGTCTTCCTCCCCG GGG Intronic
900545787 1:3228510-3228532 GGCACAGGACTTCCTCCCTGGGG - Intronic
904171307 1:28593609-28593631 GAGGCAGGACCTCCTCCCCCTGG - Intronic
906705905 1:47895156-47895178 AACTCAGGTCTTCCTCCCTGTGG - Intronic
907158810 1:52356933-52356955 GCTCCAGGTCTTCCTCCACGGGG + Intronic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
920312605 1:205057430-205057452 GAAGCAGTTCTACCTCCCAGGGG - Intronic
1062802626 10:391350-391372 GACCCAGGTCTTCCTTCCTCTGG - Intronic
1063577521 10:7275128-7275150 GCCCCAGGTCTGCCTCCCTGCGG - Intronic
1066103762 10:32139439-32139461 TAGGCAGGACTGCCTCCCCGCGG - Intergenic
1072009894 10:91293263-91293285 GACGCTGGTGTTCTTCCCCTGGG - Intergenic
1072555663 10:96512474-96512496 GAGGCAGGTGCTCCTTCCCGGGG - Intronic
1078395357 11:10976602-10976624 GAGGCAGGTCTTCCCCCTCTGGG - Intergenic
1079452272 11:20607206-20607228 AAGGCAGGTCTCCCTCCCTGGGG - Intronic
1081981409 11:47269530-47269552 GCCTCAGGACATCCTCCCCGCGG - Intronic
1082260710 11:50074646-50074668 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1089385981 11:118068321-118068343 GCCGGAGGGCTCCCTCCCCGAGG - Intergenic
1089593554 11:119560425-119560447 GCCACAGGTCTCCCTCCTCGAGG - Intergenic
1089665413 11:120014785-120014807 GAGGCAGGACTTCCTGCCTGTGG - Intergenic
1096097636 12:48946950-48946972 GACCCTGGTCTTCCTTCCCCTGG - Intronic
1103898690 12:124291917-124291939 GAGGAAGGTCTTCCTTCCCAGGG + Intronic
1104996137 12:132658136-132658158 TACGCACGTGTTACTCCCCGAGG - Intronic
1106182390 13:27380753-27380775 GACACAGGTCTCCCTCCCAGGGG - Intergenic
1122267395 14:100553106-100553128 GACGCCTGTTTTCCTCCCCCAGG + Intronic
1128510439 15:68311008-68311030 GACGCAAGTCTTCCTCCACTGGG + Exonic
1130994676 15:88897222-88897244 GCCTCAGGTCTCCCTCCCGGGGG - Intergenic
1131270946 15:90947372-90947394 GAAGCTGGTCTTCCTCCCTGGGG + Intronic
1131384655 15:91993970-91993992 GAAGCAGGTCTTCCAGCCCCAGG + Intronic
1134317115 16:13128703-13128725 GACCCAAGTCTGCCTCCCAGTGG - Intronic
1141705385 16:85661759-85661781 GAGAAAGGTCTGCCTCCCCGCGG + Exonic
1141734850 16:85845503-85845525 AACGCAAGGCTTCCTCCCGGTGG - Intergenic
1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG + Intronic
1147998538 17:44374834-44374856 GAGGCAGGGCTTCCCCGCCGGGG - Intronic
1152689412 17:81711293-81711315 GCTGCAGGTCTTCATCCCTGTGG + Intergenic
1155053119 18:22165198-22165220 GGCGCCGGCCTCCCTCCCCGCGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160745917 19:710531-710553 GACGGAGATCTCCCTCCCAGAGG + Intronic
1161373988 19:3929473-3929495 GCCCCAGGCCTTGCTCCCCGTGG - Intergenic
1161775425 19:6259543-6259565 GATGCAGGTCCTCCTCACAGCGG - Intronic
1162315344 19:9935424-9935446 GAAGCGGGTCTCCCTCCCCATGG - Intronic
1162458929 19:10802972-10802994 CACGCAGGCCTTCCTGCCTGAGG + Intronic
1164004460 19:21135891-21135913 CAGGCAGGGCTTCCTCCCTGAGG + Intergenic
1164136640 19:22422530-22422552 CAGGCAGGGCTTCCTCCCTGAGG + Intronic
1166828751 19:45625744-45625766 GACACAGGGCTTCCTCCCATAGG - Intronic
1168588028 19:57609933-57609955 GAAGCAGGTCTGCCTCTACGTGG + Intronic
927794339 2:26034661-26034683 GACGCAGGTCTTCCCCACTCCGG - Exonic
928683745 2:33727751-33727773 GACCCTGGTCATCCTCCTCGTGG - Intergenic
937992187 2:127670719-127670741 GAGGCAGGGCTGCCTCCCCAAGG + Intronic
938381319 2:130837822-130837844 CACACAGGTCTGCCTCCCCCTGG - Intronic
942101499 2:172588750-172588772 TACGGAGGGCTTCCTCCCTGTGG + Intronic
946172592 2:217904360-217904382 GGCCCAGGTCCTCCTCCCCCGGG + Intronic
947265428 2:228274394-228274416 TACGCATGTCTGCCTCCACGTGG + Intergenic
947348961 2:229222613-229222635 GAAGCAGGTTGTCCTCCCCAGGG + Intronic
947602673 2:231464251-231464273 CGCGCAGGCCCTCCTCCCCGCGG + Intronic
949046042 2:241873118-241873140 GGCGCTCGTCTTCCTCCCGGCGG - Exonic
1169075768 20:2759109-2759131 GGTCCAAGTCTTCCTCCCCGGGG + Intronic
1183721447 22:39565092-39565114 GCCTCAGGTCTTCCTCCACCAGG + Intergenic
1185318305 22:50188550-50188572 CACGCAGCTCTTGCTCCCCCGGG - Intronic
955334553 3:58074339-58074361 CAGGCAGGTCTTGCTCCCCTAGG + Intronic
970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG + Intronic
985372809 4:189304367-189304389 GACTCAGTTCTACCTCCCCGAGG + Intergenic
986079173 5:4371740-4371762 CATCCAGGTCTTCCTCCCCCAGG + Intergenic
997685637 5:135786019-135786041 GACGGTGGTATTTCTCCCCGTGG + Intergenic
998687447 5:144545274-144545296 GAGGCAGGGCTTTCTCCCAGAGG - Intergenic
1001196635 5:169678974-169678996 CACCCATGTCTTCCTCTCCGTGG - Intronic
1002943510 6:1739088-1739110 GACCCAGGTCTTCATGCCTGTGG - Intronic
1003936073 6:10976618-10976640 GACGCTGCTCTTCTTCCCCGAGG - Intronic
1004803677 6:19178822-19178844 AACGCAGGACTTCCTTCCTGAGG - Intergenic
1019139708 6:169935717-169935739 CACTCAGGTCTTCCTCCTCTTGG + Intergenic
1020015284 7:4827730-4827752 AACACGGGTCTCCCTCCCCGAGG + Intronic
1023400745 7:39792023-39792045 GGCCCAGCTCTTCCTCCCGGCGG + Intergenic
1024074210 7:45810538-45810560 GGCCCAGCTCTTCCTCCCGGCGG + Intergenic
1024649122 7:51389660-51389682 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1025131305 7:56375463-56375485 GGCCCAGCTCTTCCTCCCGGCGG - Intergenic
1027315191 7:76981154-76981176 GACGCAGCTCCTCCTTCCCTGGG + Intergenic
1029985205 7:104916673-104916695 GAGGCTTGTCTTCCTCTCCGTGG - Intergenic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1033023431 7:137750276-137750298 GATGCAGGTCTTCCTACTCCTGG + Intronic
1035022640 7:155808479-155808501 GACCCGGGTCTCCCTGCCCGGGG - Intronic
1035255049 7:157620872-157620894 AACCCAGGCCTCCCTCCCCGGGG + Intronic
1036688124 8:10925063-10925085 TAGGCAGGTCTTCCTCCTCCTGG + Intronic
1036823189 8:11955836-11955858 GACCCAGGCTTTCCTCCCTGCGG - Intergenic
1040010359 8:42656564-42656586 GAAGCAGGGCTTCCTCCTCAAGG + Intergenic
1040554417 8:48466478-48466500 TGCGGAGGTCTTCCTCCCTGAGG - Intergenic
1050050232 9:1592388-1592410 GACTCACGTCTACCTCCCCCAGG - Intergenic
1053273490 9:36766207-36766229 GAGGCGGGGCTTCCTCCGCGGGG - Intergenic
1061150648 9:128826262-128826284 GACACAGGTCTTGCTCTCCCAGG + Intronic
1061589852 9:131591309-131591331 GACTCAGGACTTCCTACCCCAGG + Intronic
1185596955 X:1313023-1313045 GAAGCAGGTCCACCTCCCCAAGG + Intergenic