ID: 1142137525

View in Genome Browser
Species Human (GRCh38)
Location 16:88458473-88458495
Sequence CAGTTGGAGAAGAAAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 1, 2: 4, 3: 85, 4: 700}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142137512_1142137525 24 Left 1142137512 16:88458426-88458448 CCAGGAACCCAGTGTGGCATCCA 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG 0: 1
1: 1
2: 4
3: 85
4: 700
1142137518_1142137525 4 Left 1142137518 16:88458446-88458468 CCAGCACCACTGGGGATTTAAAT 0: 1
1: 0
2: 6
3: 87
4: 1291
Right 1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG 0: 1
1: 1
2: 4
3: 85
4: 700
1142137521_1142137525 -2 Left 1142137521 16:88458452-88458474 CCACTGGGGATTTAAATGGGTCA No data
Right 1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG 0: 1
1: 1
2: 4
3: 85
4: 700
1142137514_1142137525 16 Left 1142137514 16:88458434-88458456 CCAGTGTGGCATCCAGCACCACT 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG 0: 1
1: 1
2: 4
3: 85
4: 700
1142137513_1142137525 17 Left 1142137513 16:88458433-88458455 CCCAGTGTGGCATCCAGCACCAC 0: 1
1: 0
2: 1
3: 6
4: 179
Right 1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG 0: 1
1: 1
2: 4
3: 85
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142137525 Original CRISPR CAGTTGGAGAAGAAAGGAGG AGG Intronic
900141714 1:1141547-1141569 CAGTTGGGGAAGCAGGGATGGGG - Intergenic
900241014 1:1617230-1617252 CAGCTGGAGGTGCAAGGAGGAGG + Intronic
900833965 1:4985610-4985632 CAGTTGGAGAACAGAGGATGTGG - Intergenic
901355613 1:8645293-8645315 CAGTTCAAGAAGAACAGAGGTGG - Intronic
902668560 1:17956030-17956052 CAGTCTGAGAAGCAAGGAGAAGG - Intergenic
902718946 1:18291548-18291570 CACCTGGAGAAGAAAGGAAGTGG - Intronic
903050243 1:20595164-20595186 CAGACGGAGAGGAAAGGAGGAGG - Intronic
903590498 1:24452218-24452240 CAGTTGTTGATGCAAGGAGGGGG + Intronic
904179606 1:28656880-28656902 TATTTGGAGAAGAAGGCAGGCGG - Intergenic
904688947 1:32279598-32279620 CAGTTGGAGGAGAAAGGTCTGGG + Intronic
904840445 1:33368789-33368811 CAGTAGAAGCAGAAAGGAAGGGG + Intronic
905000261 1:34662463-34662485 CATTTGGAGAAGATTTGAGGAGG - Intergenic
905575917 1:39044540-39044562 AAGAAGGAGAAGAAAGAAGGAGG + Intergenic
906156621 1:43617714-43617736 CCTATGGATAAGAAAGGAGGTGG - Exonic
906344053 1:45004286-45004308 GAGTTGGAGAAGAAAGTGTGTGG - Exonic
906745967 1:48222442-48222464 GAGCAGGAGGAGAAAGGAGGGGG - Intergenic
907013923 1:50992492-50992514 GAGATGAAGAATAAAGGAGGTGG - Intergenic
907948637 1:59159149-59159171 CAGTAGTAGGAGATAGGAGGGGG + Intergenic
909660004 1:78071528-78071550 AAGAAGGAGAAGGAAGGAGGAGG - Intronic
910217180 1:84854268-84854290 CAGGTGGAGAGGAAAGGGGAAGG - Intronic
910275695 1:85446811-85446833 AAGGAGAAGAAGAAAGGAGGAGG - Intronic
910556902 1:88544384-88544406 CAGTTGGATAAGAAGTGAGTGGG + Intergenic
911256884 1:95643460-95643482 CAATGGGTGAAGATAGGAGGAGG + Intergenic
912090595 1:106070054-106070076 CTCTTGGTGAAGACAGGAGGCGG - Intergenic
912141259 1:106731093-106731115 GAGTTGGTGGAGGAAGGAGGTGG + Intergenic
912703434 1:111895145-111895167 GAGAAGGAGAAGGAAGGAGGGGG + Intronic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
913432773 1:118813636-118813658 GAGTTTGAGAAGGGAGGAGGGGG - Intergenic
915029125 1:152861059-152861081 CAGGAGGAGAAGGAAGGAGGAGG - Intergenic
915194980 1:154182716-154182738 GAGGTGGAGAAAAAAAGAGGAGG + Intronic
915596463 1:156899280-156899302 GAGATGGAGAAGAGAGGAGGGGG + Intronic
915646383 1:157275713-157275735 CAGTTGGAGAAGCTGTGAGGGGG + Intergenic
915835598 1:159172757-159172779 GAGTCGGGGGAGAAAGGAGGCGG + Intronic
916051203 1:161038336-161038358 CAGTTTGAGAAGACAGCAGGCGG - Intronic
916100808 1:161391566-161391588 CAGCTGGAGAGTAAAGGAGGGGG + Intergenic
916146512 1:161744932-161744954 AAGATGGGGAACAAAGGAGGAGG - Intergenic
916452519 1:164934609-164934631 GAGTTGGAGAGGAAAGGAGGTGG + Intergenic
916718547 1:167465114-167465136 CTGAAGGAGAAGAAAGGAGGTGG - Intronic
916718629 1:167465629-167465651 CAGGTGAAGAAGAAAGAAAGGGG - Intronic
917259232 1:173148876-173148898 CAGTTGGAGAACAACGGTTGGGG + Intergenic
917502154 1:175595319-175595341 TATTTGGAAAAGAAAGGAGTTGG - Intronic
917594051 1:176509669-176509691 GAGTTTCAGAAGAATGGAGGGGG + Intronic
917606149 1:176631929-176631951 CAGGTGGAGGAGAGAAGAGGGGG + Intronic
917624226 1:176829701-176829723 CTGTGGGAGATGAAAGGATGAGG - Intronic
917773835 1:178311660-178311682 AAGTGAGAGAAGAAAGGTGGAGG - Intronic
918708342 1:187696390-187696412 CAGTGGGAGAGGGTAGGAGGAGG + Intergenic
919140175 1:193560480-193560502 GAGTTGGAGAAGAGAGAAAGAGG - Intergenic
919375574 1:196790093-196790115 CACTTTTAGTAGAAAGGAGGTGG - Exonic
919385274 1:196915004-196915026 CACTTTTAGTAGAAAGGAGGTGG - Exonic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
919675888 1:200382661-200382683 GAGCTGGAGAAGAATGGAGGTGG - Intergenic
920269855 1:204754750-204754772 TTGTGGGAGAGGAAAGGAGGAGG + Intergenic
920446764 1:206023821-206023843 CGGGGAGAGAAGAAAGGAGGGGG - Exonic
922251842 1:223856495-223856517 GAGTGGGAGCAGAAGGGAGGCGG + Intergenic
922744446 1:228036439-228036461 CAGATGGGGATGAAAGCAGGAGG - Intronic
923334914 1:232959902-232959924 CAGGTGGGGAAGTAAGGATGTGG + Intronic
923432482 1:233936649-233936671 AAGAAGGGGAAGAAAGGAGGAGG - Intronic
923518221 1:234715488-234715510 CTGTAGGAGAACAAAGGAAGTGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924049215 1:240063410-240063432 CATTTTAAGAAGCAAGGAGGCGG - Intronic
924548529 1:245052662-245052684 CAGGTGGAGAAGAATAGAGGGGG + Intronic
1062781122 10:208772-208794 GAGGTGGAGAAGGAAGAAGGTGG + Intronic
1062846028 10:706282-706304 GAGAAGGAGAAGAAGGGAGGTGG - Intergenic
1063502733 10:6569782-6569804 CAGTTGCAGAAAAGAGCAGGAGG + Intronic
1064022532 10:11821335-11821357 CAGTTGAAAAAGAAATGAGAGGG - Intergenic
1064121755 10:12625015-12625037 AAGAAGAAGAAGAAAGGAGGAGG - Intronic
1064255101 10:13736797-13736819 CCGGTGGAGAATAAAGGAGATGG - Intronic
1064444945 10:15384754-15384776 CAGTTGGAGAACAGAGGTGGGGG + Intergenic
1064714323 10:18161072-18161094 CAGTTGGAGGATAAAGAAGAGGG + Intronic
1064850840 10:19707055-19707077 GAGAAGTAGAAGAAAGGAGGAGG - Intronic
1065623821 10:27610641-27610663 AAGAAGGAGAAGAAAGAAGGAGG - Intergenic
1066444052 10:35465612-35465634 CAGTTGAAGAAGAAAAGCTGTGG - Intronic
1066475507 10:35743381-35743403 GAGTTGAAGAAGAAGGGAGTTGG + Intergenic
1067656130 10:48192992-48193014 CAGCAGAAAAAGAAAGGAGGAGG - Intronic
1067812072 10:49437507-49437529 TAGCTGGGGAAGAAAGGTGGAGG + Intergenic
1069949620 10:72009942-72009964 CAGAGGGAGAGGACAGGAGGAGG + Exonic
1070312864 10:75286466-75286488 AGGCTGGAGAAGAAAGCAGGAGG - Intergenic
1070456763 10:76624771-76624793 GAGTAGGAGAAGAAAGGGGACGG - Intergenic
1070502537 10:77085038-77085060 CAGATGGTTGAGAAAGGAGGTGG - Intronic
1070526588 10:77300782-77300804 GGGCTGGAGAAGAAAGGAGATGG - Intronic
1070588396 10:77783257-77783279 CAATTGGAGAAGAAAGGCCCAGG - Intergenic
1070656751 10:78276867-78276889 CTGTTGGAGGAGAAGGGAAGGGG - Intergenic
1072085646 10:92076841-92076863 AAGAGAGAGAAGAAAGGAGGAGG + Intronic
1072331742 10:94360567-94360589 CAGTTGGAGGAGATAGGAGTAGG + Intronic
1072850690 10:98888649-98888671 CAGTTTGGGGAGAAAGGAGACGG - Intronic
1073064363 10:100749606-100749628 GAGCTTGAGAAGAAAGGTGGTGG - Intronic
1073524047 10:104162799-104162821 AAGTTGGGCAAGAAAGGGGGTGG + Intronic
1073939595 10:108680388-108680410 GGGTTGGGGAAGAAAGGAGAAGG - Intergenic
1074148743 10:110739957-110739979 CACTTGGAGAAGGAGGGAGAGGG - Intronic
1074149727 10:110747456-110747478 CAGAAAGGGAAGAAAGGAGGTGG - Intronic
1074193187 10:111155725-111155747 CACTTGGTGAGGAGAGGAGGTGG - Intergenic
1074777555 10:116777442-116777464 CAGGTGGGGCAGGAAGGAGGAGG - Intergenic
1075433477 10:122411276-122411298 CAGGTGGAGAAGGAAGGGAGAGG + Intronic
1075576916 10:123584353-123584375 CATTTGGGGAAGAAGGAAGGGGG + Intergenic
1075728596 10:124623237-124623259 CAGATAGAGAAGAACTGAGGGGG - Exonic
1075931210 10:126297780-126297802 CAGATGGAGAAGAAAACAGAAGG + Intronic
1075985744 10:126783688-126783710 CAGCTGGGGAAGAAGGGAGAAGG - Intergenic
1076318862 10:129564169-129564191 GAGTGGAAGAAGAAGGGAGGGGG - Intronic
1077826313 11:5812191-5812213 TACTTTGAGAAGAAATGAGGAGG + Intronic
1077885559 11:6385055-6385077 CAGTAGGAAAAGGAGGGAGGAGG - Intergenic
1077955381 11:7013653-7013675 CAGTGAGAGAGAAAAGGAGGTGG - Intronic
1077979110 11:7281499-7281521 CAGGTGTAGAAGAAAGGAAGTGG - Intronic
1078593374 11:12665237-12665259 CAGGAGGAGAAAGAAGGAGGAGG + Intergenic
1078727798 11:13947365-13947387 AAGTTGGAGAAGAGAGTTGGTGG - Intergenic
1078744778 11:14101526-14101548 CAGAAAGAGAAAAAAGGAGGAGG - Intronic
1078877793 11:15415461-15415483 TAGTGGGAGGAGAAGGGAGGAGG + Intergenic
1079408032 11:20162485-20162507 GAGTGGGAGAAGGAGGGAGGTGG - Intergenic
1079987771 11:27216411-27216433 CAGCTGGACAAGGAAGGGGGTGG + Intergenic
1080605364 11:33860819-33860841 CAGTTGGGTAGGGAAGGAGGAGG - Intronic
1080943276 11:36943314-36943336 AAGTTGGATAAGAAAGGAAATGG + Intergenic
1081489482 11:43556533-43556555 GGGAGGGAGAAGAAAGGAGGGGG - Intronic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1081635474 11:44718660-44718682 CAGAAGGAGAGGGAAGGAGGGGG + Intergenic
1081737785 11:45416346-45416368 GAGTTGGAGAAGGATGTAGGTGG - Intergenic
1082783246 11:57302679-57302701 CTGTTGGAGGAGGAAGGAGCCGG - Exonic
1085364073 11:75921794-75921816 CAGTGGGAAAAGAAAGGTGCTGG - Intronic
1085379729 11:76104094-76104116 CAGGTGGAAAATAAAGGAGTTGG - Intronic
1085922802 11:80979130-80979152 CTGCTGGAGAAGAAAGAAAGAGG - Intergenic
1086056115 11:82649062-82649084 AAGGAGCAGAAGAAAGGAGGAGG - Intergenic
1087557673 11:99743108-99743130 CAGTATGATAAGGAAGGAGGAGG + Intronic
1088256670 11:107909723-107909745 AAGGTGGATAAGGAAGGAGGTGG - Intronic
1088329466 11:108635364-108635386 CAGGTGGACAAGGAAGTAGGAGG - Intergenic
1088334438 11:108687872-108687894 CAGTGAAAGAAAAAAGGAGGAGG - Intronic
1088864913 11:113838455-113838477 CAGTGGGATAGGAAAGGTGGTGG - Intronic
1089172340 11:116521709-116521731 GAATGGGAGAAGAAAAGAGGAGG + Intergenic
1089540298 11:119185788-119185810 CCTTTGGAGCAGAAAGGAGGGGG + Intronic
1089623307 11:119735243-119735265 CAAGGGGAGAGGAAAGGAGGAGG + Intergenic
1089709321 11:120303508-120303530 GGATTGGAGATGAAAGGAGGAGG + Intronic
1089739971 11:120575721-120575743 CACAAGGAGAAGAGAGGAGGGGG - Intronic
1090007582 11:123016658-123016680 TAGTTGGAAAAAAAAGGAGAAGG - Intergenic
1090465313 11:126928319-126928341 GAGGTGGGGAAGAAATGAGGTGG + Intronic
1090643618 11:128749750-128749772 AAGTTGGATAAGGAAGAAGGTGG - Intronic
1091112192 11:132979841-132979863 CTGATGGAGAAGAAGGCAGGGGG + Intronic
1091567964 12:1662106-1662128 CAGTGGGAGAAAACAGGAGAGGG - Intergenic
1091743815 12:2978072-2978094 CAGCTGGAAAAGAAAAGAGAAGG - Intronic
1092090873 12:5802753-5802775 CAGTTGGTGAAGAGAGGACATGG - Intronic
1092979355 12:13778135-13778157 CAATTGAGGAAGAAAGGAGCGGG - Intronic
1093508403 12:19896782-19896804 AAGAAGGAGAAGGAAGGAGGAGG - Intergenic
1093754948 12:22842102-22842124 GAGGAGGAGAAGAAAGGAGAAGG - Intergenic
1094129877 12:27063392-27063414 GAGAAGGAGAAGAAAGAAGGGGG - Intronic
1094203678 12:27818178-27818200 CAGTTGTAGAAGAAAGCATCGGG + Intergenic
1094241153 12:28226330-28226352 CACTGGGAAAAGAAACGAGGTGG - Intronic
1094318029 12:29153493-29153515 CAGTTGGAGAGGGGAGCAGGTGG + Intronic
1094371071 12:29737996-29738018 CAGTTGGAGAAGAAAGGGAGTGG - Intronic
1094530678 12:31271727-31271749 CATTTGGGGAAGGAAGAAGGTGG + Intergenic
1094777615 12:33749289-33749311 CAGATGGATAAGAAAGTAGTGGG + Intergenic
1095041490 12:37446654-37446676 CAGGTGAATAAGAAGGGAGGGGG - Intergenic
1095248585 12:39951690-39951712 AAGTTGAAGAACAAAGGAAGTGG - Intronic
1095730545 12:45501731-45501753 CAGTTAAAGAAGAAATGAGTTGG + Intergenic
1095926725 12:47586050-47586072 AAGTTTCAGAAGAAAGGAGTTGG + Intergenic
1096077510 12:48814668-48814690 CAGTTCCTGGAGAAAGGAGGGGG + Intronic
1096445531 12:51687448-51687470 CAGCTGGGAGAGAAAGGAGGAGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096838675 12:54368178-54368200 GTCTTGCAGAAGAAAGGAGGAGG - Intergenic
1097085242 12:56463029-56463051 CCCTAGGAAAAGAAAGGAGGAGG - Intronic
1097140140 12:56895564-56895586 CACATGGATAAGAAAGAAGGAGG - Intergenic
1097199755 12:57268571-57268593 CAGATGGGGAAAACAGGAGGAGG - Intronic
1097616556 12:61890882-61890904 CAGTGGGAGAAAAAAGGCAGTGG + Intronic
1097776805 12:63656642-63656664 CAGTGGGAGAGGAAAGGATGAGG - Intronic
1098164641 12:67681498-67681520 AAGTGGGAGAAGTAGGGAGGGGG + Intergenic
1098825361 12:75289685-75289707 CAGTTGGACAAGGAAGGAAATGG - Exonic
1099704627 12:86136394-86136416 GAGATGGAGAATAATGGAGGTGG + Intronic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1100450706 12:94703114-94703136 GAGTAGGAGAAGAAAGGAAAAGG - Intergenic
1100762129 12:97819648-97819670 CAGATGGAGAAAAAAGCAGCTGG - Intergenic
1101109681 12:101473518-101473540 AAGTTGGAGAAGAAAGAGGCAGG - Intergenic
1101429056 12:104611886-104611908 CAGTTGGAGAGAATAGGAGCAGG + Intronic
1101709150 12:107248825-107248847 GAGATGGAGAAGAATGCAGGTGG - Intergenic
1101917501 12:108907255-108907277 GAGGAGGAGAAGGAAGGAGGAGG - Intergenic
1103021175 12:117535553-117535575 CAAAGGGAGAAGAAAGGAGGTGG - Intronic
1103195737 12:119042280-119042302 TGGTGGGAGAGGAAAGGAGGAGG + Intronic
1103318662 12:120077367-120077389 CACTTGGGGAACAGAGGAGGAGG - Intronic
1104781277 12:131422095-131422117 CAGGTGGAGGAGGAGGGAGGAGG - Intergenic
1105510038 13:21043511-21043533 GAGTTGGAGGGGAAAGGTGGAGG + Intronic
1106202272 13:27549404-27549426 CACTGGGAGAAGAAAAGAGAAGG - Intronic
1106558371 13:30829085-30829107 CAGGTTTAGAAGAAAGCAGGAGG - Intergenic
1106748710 13:32734109-32734131 CACTTGAACAAGAAAGGTGGAGG - Intronic
1107201260 13:37721093-37721115 TAGTTAGAAAAGAAAGGAGAAGG + Intronic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107331651 13:39307540-39307562 CAATTGGAGAAGAAAACGGGAGG - Intergenic
1107449757 13:40497826-40497848 CAGCTGGAGCAGACAGGAAGAGG - Intergenic
1107897120 13:44976299-44976321 GAGAAGGAGAAGAAAGGAGGAGG + Intronic
1108093634 13:46877951-46877973 CAGCTGGAGAATAAAAGATGAGG + Intronic
1108112731 13:47093738-47093760 GTGTTGGAGAAGATTGGAGGAGG - Intergenic
1108478320 13:50843037-50843059 CAGTGGGAGAAGGAAGGGGGCGG - Intronic
1108753342 13:53471461-53471483 CAAATGGAGAAGTCAGGAGGTGG + Intergenic
1109379769 13:61543985-61544007 CTGTTGGGGAAGAAAGGAGCAGG + Intergenic
1110096581 13:71530995-71531017 CAGATGGAGAAGGCAGGTGGTGG + Intronic
1110515824 13:76411413-76411435 GAGGAGGAGGAGAAAGGAGGGGG + Intergenic
1110563093 13:76930175-76930197 CAGCTGGAGAGTAAGGGAGGGGG - Intergenic
1110642067 13:77836566-77836588 CATATGTAGATGAAAGGAGGAGG + Intergenic
1111078899 13:83276738-83276760 CAGCTGGAAAGGAAAGGAGCAGG - Intergenic
1111224472 13:85251782-85251804 CAATTGGAGAAGAAAGCTCGAGG + Intergenic
1111514409 13:89309433-89309455 CAGTTGGAGAAAAAAGGTTCTGG - Intergenic
1112586390 13:100722610-100722632 CAGTCGGGGGAGAATGGAGGAGG + Intergenic
1113611146 13:111645778-111645800 CAGTGGGAGAGGCCAGGAGGCGG + Intronic
1114465921 14:22922667-22922689 CAGTAAGGGAAGAAAGCAGGAGG + Intronic
1114712857 14:24795893-24795915 GGGTTGGAGAAGAAAAGAAGAGG - Intergenic
1115165096 14:30439360-30439382 CTGGGGGAGAAGAGAGGAGGGGG - Intergenic
1115518487 14:34209088-34209110 CTGTTTAAGAGGAAAGGAGGAGG + Intronic
1116811579 14:49544908-49544930 CAACAGGAGAGGAAAGGAGGTGG - Intergenic
1117205025 14:53433348-53433370 AAGGTTGAGAAGAATGGAGGTGG - Intergenic
1117458007 14:55917197-55917219 GAGGTGGGGTAGAAAGGAGGAGG + Intergenic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118886478 14:69870989-69871011 CATGTGGAGAGGAATGGAGGTGG + Intronic
1119180158 14:72600086-72600108 AAGGAGGAGAAGAAGGGAGGGGG - Intergenic
1119470658 14:74896100-74896122 CAGTGGGAGACCAAAGCAGGAGG - Intronic
1119555131 14:75547214-75547236 GAGGAGGAGGAGAAAGGAGGAGG - Intergenic
1119684838 14:76623353-76623375 CATGTGGAGAAGAAGGGAGGAGG - Intergenic
1119685920 14:76631160-76631182 GACAGGGAGAAGAAAGGAGGTGG + Intergenic
1119738186 14:76997388-76997410 CCACTGGAGAAGAATGGAGGTGG - Intergenic
1119881010 14:78099744-78099766 GAGTTGGGGAAGTAGGGAGGAGG + Intergenic
1119994658 14:79240252-79240274 CATATGGAGAAGAAAGAAGATGG - Intronic
1120277810 14:82399367-82399389 CAGCTGGAGAAAAGAGGATGGGG + Intergenic
1120401836 14:84042104-84042126 CCTTTGGAGAAGGAAGGAGAGGG + Intergenic
1120401839 14:84042177-84042199 CTTTTGGCTAAGAAAGGAGGGGG - Intergenic
1120727535 14:87961893-87961915 CATTTGGAGAGGAAGGGATGAGG - Intronic
1121057382 14:90869520-90869542 CAGTAAGTGAAGAAGGGAGGGGG + Exonic
1121066780 14:90974666-90974688 CATATGGAGGAGAAAAGAGGTGG + Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121577276 14:94998423-94998445 GATTTGGAGAAGGAAGTAGGAGG + Intergenic
1121697448 14:95925299-95925321 CTGCTGAACAAGAAAGGAGGTGG + Intergenic
1121885436 14:97538633-97538655 CAGTGAGAGAAGATAGCAGGAGG - Intergenic
1122198133 14:100105052-100105074 TAGATGGAGCAGCAAGGAGGTGG - Intronic
1122846227 14:104500759-104500781 GAGAGGGTGAAGAAAGGAGGGGG + Intronic
1124205557 15:27716063-27716085 GAGATGGAGAAGAAGGGTGGAGG - Intergenic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1124745939 15:32342480-32342502 CAGTTGCGGGAGAAAGGGGGGGG + Intergenic
1125008016 15:34839657-34839679 CAGCTGCAAAAGAAATGAGGAGG - Intergenic
1125104061 15:35950046-35950068 CAGCTGGGAAAAAAAGGAGGTGG + Intergenic
1125399397 15:39284042-39284064 CAAATGAAGAAGAAAGGAGGTGG + Intergenic
1125637696 15:41203256-41203278 CAGTGGGAGAGGAATGGGGGAGG - Intronic
1125888979 15:43251722-43251744 CACATGGAGGTGAAAGGAGGAGG - Intronic
1125895991 15:43302082-43302104 CAGATGGAGAAGTAAGAAGAAGG + Intronic
1126688550 15:51269116-51269138 CACTTACAGAAGAAAAGAGGAGG - Intronic
1127122065 15:55780375-55780397 GAGGAGGAGAAGAAAGAAGGTGG + Intergenic
1127122102 15:55780576-55780598 AAGAAGAAGAAGAAAGGAGGAGG + Intergenic
1127329366 15:57923624-57923646 CAATTAAAGAAGAAAGGAGGAGG - Intergenic
1127963559 15:63907753-63907775 CTGTTAGGGAAGCAAGGAGGAGG + Exonic
1128363735 15:66982186-66982208 CACTTGGGGAAGAGAGGAGGCGG - Intergenic
1128916156 15:71564441-71564463 CAGTTGAAGAAGATTGGAGGTGG + Intronic
1128939989 15:71780156-71780178 CAGTGACAGAAGAAAGGAGAGGG - Exonic
1128992307 15:72271459-72271481 GAGTTGGAAAAGGAAGGTGGTGG + Intronic
1129199914 15:73992481-73992503 GAGTAGGAGAAGAGGGGAGGAGG - Intronic
1129683453 15:77671359-77671381 AAGGAGGAGAAGAAAAGAGGTGG + Intronic
1130376227 15:83331573-83331595 CAGTTGCAGAATAAAGGAGTGGG + Intergenic
1130657925 15:85805322-85805344 GAGTTGGAGAAGAAAAGATGAGG + Intergenic
1131034979 15:89216199-89216221 CATTTGGAGAAGGAAGAAGTAGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131559546 15:93427514-93427536 CAGCTGGAAAAGAAAGGTGTAGG + Intergenic
1131852112 15:96554579-96554601 GAGTAGGAGAAGGAGGGAGGAGG - Intergenic
1132008249 15:98250264-98250286 CAGTTGGATAAGATGGGATGGGG + Intergenic
1132078631 15:98845483-98845505 GAGGAGGAGAAGGAAGGAGGAGG - Intronic
1132644602 16:993042-993064 CAGGGGGAAAAAAAAGGAGGGGG + Intergenic
1134676355 16:16093380-16093402 CAGCTGGGAAAGAAAGGCGGGGG - Intronic
1134813473 16:17186959-17186981 CAGATGGAGCAGCAAGGAAGGGG + Intronic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135772632 16:25228868-25228890 CAGCTTGAGAAGCAAGGAAGTGG - Exonic
1136513775 16:30755732-30755754 TAGTTGGAGATTATAGGAGGAGG + Intronic
1138032524 16:53571173-53571195 CAGCTGGAAAAAAAAGGAAGGGG + Intergenic
1138371750 16:56532600-56532622 CAGGTGGAGATGAAAGTGGGAGG - Intergenic
1138482802 16:57315139-57315161 CAGTTTAAGGAGAAAGGTGGGGG - Intergenic
1138683904 16:58707927-58707949 AAGTTGGAGAAAAAAGGACCGGG + Exonic
1138824037 16:60297315-60297337 CAGGTGGGGTAGAAAGGATGAGG - Intergenic
1140282633 16:73568591-73568613 CAGTTGGACAAGAAAGGGGAAGG + Intergenic
1140357601 16:74319578-74319600 AAGAAGGAGAAGAAAGGAGGAGG - Intergenic
1140394492 16:74615081-74615103 CAGTTGTAGGAAAAATGAGGTGG + Intergenic
1140712921 16:77695059-77695081 CAGCTGGAGGAAAAAGGAGAGGG - Intergenic
1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG + Intronic
1143364930 17:6400891-6400913 AAGTTGGGGAAGAGAGAAGGTGG - Intronic
1143570621 17:7755713-7755735 CAGCTGGAACAGGAAGGAGGAGG + Intronic
1143622078 17:8086465-8086487 GAGTGGGAGAAGACAGGAGCTGG - Intronic
1144338660 17:14295687-14295709 CACCTGTAGAAGGAAGGAGGAGG + Intergenic
1144590661 17:16520991-16521013 GAGTTGGAGCAGAGAGGATGGGG + Intergenic
1145086513 17:19946747-19946769 CAGCTGGAGGTGCAAGGAGGAGG - Intronic
1146216961 17:30984769-30984791 CACTGGGAGAGGAAAGGATGTGG + Intronic
1146390226 17:32415365-32415387 CAGTAGGAAAGGAAAGGAGAAGG + Intergenic
1146531295 17:33609752-33609774 CACATGAAGAAGAAAGGAGAGGG + Intronic
1146569758 17:33942127-33942149 CAGTTGGGGAAGAAGGGAGAAGG + Intronic
1146726448 17:35160150-35160172 ATGTTGGAAGAGAAAGGAGGAGG + Intronic
1146970586 17:37068503-37068525 CAGCTGGGGATGGAAGGAGGAGG + Intergenic
1147586585 17:41656684-41656706 CAGGTAGGGAAGAAAGGAAGAGG + Intergenic
1147640163 17:41992550-41992572 CAGATGGAAAAGGAATGAGGGGG + Intronic
1147753846 17:42755071-42755093 GGGTTGGAGAAGGAAGGAGGAGG + Intergenic
1148148141 17:45378970-45378992 CAGTTGGAGTAGACAGTCGGAGG - Intergenic
1148391313 17:47275220-47275242 CAGGTGTTGAAGAAAGGAGCTGG + Intronic
1148519321 17:48255127-48255149 TACTTGGTGAAGAAAGGAAGAGG + Intronic
1148579573 17:48734395-48734417 GGGTTGGAGAAGGAAGGAGGAGG - Intergenic
1149358666 17:55870125-55870147 GAGTTGGAGAGGCAAGGATGTGG + Intergenic
1149560473 17:57604727-57604749 CAGAAGGATAAGAAGGGAGGAGG + Intronic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1150150655 17:62806587-62806609 CAGGTGGAGAAGGAAGGAGGGGG + Intronic
1150205927 17:63407327-63407349 CTGCTGGGGAAGCAAGGAGGAGG + Intronic
1150228266 17:63535426-63535448 CAGTGGGAGAACAGAGGAAGGGG - Intronic
1150497970 17:65623693-65623715 CAGGTGCAGGAGCAAGGAGGTGG - Intronic
1150587214 17:66529925-66529947 CAGTTAAAGAACCAAGGAGGAGG - Intronic
1150646902 17:66984445-66984467 CAGTTGGGGATGAATGGGGGCGG - Intronic
1151080343 17:71322414-71322436 TAGTCGGAAAAGAAATGAGGTGG - Intergenic
1151099343 17:71538674-71538696 GAGTTGGAAAATAAAGGAGGAGG - Intergenic
1151239360 17:72745676-72745698 CAGTTGGAGAACAAATGGCGTGG - Intronic
1151287622 17:73124423-73124445 CTGTTGGTGAAGATAGAAGGAGG - Intergenic
1151335322 17:73436218-73436240 CACATGGAGGTGAAAGGAGGAGG + Intronic
1151889713 17:76944865-76944887 CTGATGAGGAAGAAAGGAGGTGG + Intronic
1152181332 17:78823537-78823559 CAGCTGGGCAAGAATGGAGGAGG + Intronic
1152324184 17:79626124-79626146 CAGTGGGAGAACACAGGAAGTGG + Intergenic
1152506899 17:80755297-80755319 TAGTTGGAGATGAAGGGAAGAGG + Intronic
1153246269 18:3075351-3075373 CAGATGGAGGAGAATGGAAGTGG - Intronic
1153416036 18:4846648-4846670 GAGTTGCAGAAGGAAGCAGGTGG - Intergenic
1154067977 18:11127051-11127073 TAGTTGGAGGAGAGAGAAGGAGG + Intronic
1154344391 18:13530330-13530352 CAGTGGGAGCAAAAAGGAGGAGG - Intronic
1154372860 18:13780491-13780513 CAGTTGCAGAAGAATGGCGCTGG + Intergenic
1155159951 18:23187362-23187384 CAGTTGGAGAAGAGACAAGGAGG + Intronic
1155293465 18:24364256-24364278 CATTTGCAGGAGAAAGGAGAGGG + Intronic
1155333169 18:24738312-24738334 GAGCTGGAGGAGAAAGCAGGTGG + Intergenic
1155399091 18:25418552-25418574 CACTTGGCTAAGGAAGGAGGAGG - Intergenic
1155803140 18:30134113-30134135 GAGTTGGGGAGGGAAGGAGGGGG + Intergenic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1155984194 18:32212523-32212545 CAGGTTGGAAAGAAAGGAGGTGG + Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157472057 18:47997153-47997175 TAATAGAAGAAGAAAGGAGGAGG - Intergenic
1158357317 18:56635648-56635670 CCTTTGGAGAAGTAAGGATGGGG + Intronic
1158390205 18:57038860-57038882 CAATGGGAGCACAAAGGAGGAGG + Intergenic
1158436728 18:57439620-57439642 CAAATGGAGAAGAAAAGCGGAGG + Intronic
1159176059 18:64835502-64835524 CAGTAGGAGAAGAAATGACTTGG - Intergenic
1160590440 18:79941585-79941607 CCGTTGGATAAGAAGGGAGTGGG - Intronic
1160925359 19:1542274-1542296 AAGAAGGAGAAGGAAGGAGGAGG - Intergenic
1161029668 19:2051772-2051794 CAGGGGAAGAAGAAAGTAGGTGG - Intergenic
1161289800 19:3487332-3487354 GAGTTGGTGAGGAAAAGAGGTGG + Intergenic
1161701161 19:5796346-5796368 AAGAAGAAGAAGAAAGGAGGAGG - Intergenic
1161899797 19:7109922-7109944 AACTGGGAGCAGAAAGGAGGAGG + Intergenic
1162654297 19:12117146-12117168 CCAATGGAGAAGAAAGGAGCAGG + Intronic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164458293 19:28426994-28427016 GAGTTGGGGAAGGAAGGAGGTGG + Intergenic
1165087836 19:33363718-33363740 AAGTGGGAGAGGGAAGGAGGAGG - Intergenic
1165215624 19:34270143-34270165 CAGTTGCACAGGAAATGAGGCGG + Intronic
1165580048 19:36854621-36854643 GAGCTGGAGAAGATAGGAGTGGG - Intronic
1166169115 19:41014853-41014875 GAGTAGGAAAAGGAAGGAGGAGG + Intronic
1166191009 19:41176600-41176622 CAGTTGCAGAAGAAGGGATGTGG + Intergenic
1166329503 19:42069968-42069990 CAGGTGGAAGAGAAAGGCGGAGG + Intronic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1167227030 19:48252169-48252191 CAGCTGCAGAAGAAAGTATGGGG - Intronic
1167701929 19:51053690-51053712 GTGTTAGAGAATAAAGGAGGAGG - Intergenic
1167704387 19:51070437-51070459 CACTGGGAGAAGACAGGTGGAGG - Intergenic
1168147964 19:54430158-54430180 CAGCTGGAGCAGAAGGGATGAGG - Intronic
925912408 2:8582438-8582460 CAACTGCAGGAGAAAGGAGGAGG + Intergenic
926049682 2:9736879-9736901 CAGGTGCAGAAAGAAGGAGGGGG - Intergenic
926387828 2:12354831-12354853 CAGGTGGAGAAGAGAGTTGGAGG - Intergenic
928029627 2:27767483-27767505 TTTTTGAAGAAGAAAGGAGGAGG - Intergenic
928259384 2:29753105-29753127 CAGAAGGAGAAGAAAATAGGTGG + Intronic
928353128 2:30581359-30581381 CTGTTGTAGAAGACTGGAGGGGG - Intronic
928512231 2:32012185-32012207 AAGTTGGAGAAGGTGGGAGGAGG - Intronic
929622203 2:43366525-43366547 AAGGTGGGGAAGAGAGGAGGAGG + Intronic
930110632 2:47675803-47675825 CAGATGGGGAAGAAGGAAGGAGG + Intergenic
930245669 2:48980821-48980843 CAGTTGGATAATGAAGGAGTTGG + Intronic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931601725 2:64010467-64010489 AAGGTGGTGGAGAAAGGAGGGGG - Intronic
931732331 2:65164358-65164380 AAAGTGGAGAAGAAAAGAGGAGG + Intergenic
932023350 2:68110761-68110783 CAATTGGGAAAGAAAGGATGAGG - Intronic
932436410 2:71704789-71704811 CATTTGAAGAATAAAGGAGAAGG + Intergenic
933271874 2:80241359-80241381 CAGTTGAGGGAGGAAGGAGGAGG + Intronic
933947457 2:87298957-87298979 CTGTAAGAGAAGAAATGAGGGGG - Intergenic
934934590 2:98455552-98455574 TAGATGAACAAGAAAGGAGGAGG - Intronic
934970791 2:98762547-98762569 AACTTCGAGAAAAAAGGAGGAGG - Intergenic
935285965 2:101563941-101563963 GAGAAGGAGAAGAAAGGAGAAGG + Intergenic
935344432 2:102092762-102092784 CAGCAAGAGAAGAAAGGATGGGG + Intronic
935451153 2:103210963-103210985 AAGAAGAAGAAGAAAGGAGGAGG - Intergenic
935947950 2:108303100-108303122 AAGTTGGAGAAGAGAAGATGGGG + Intronic
936332737 2:111562610-111562632 CTGTAAGAGAAGAAATGAGGGGG + Intergenic
936982897 2:118280116-118280138 CAGGTGCTGAAGAAAGGACGAGG - Intergenic
937638454 2:124184581-124184603 GAATTGGAGAAGAAAGGACAAGG + Intronic
937791857 2:125970265-125970287 TAGTAAGAGAAGAAAGGATGTGG - Intergenic
937850061 2:126623998-126624020 CAGCAGGAGAGGTAAGGAGGTGG + Intergenic
937871386 2:126788680-126788702 CAGGTGGAGAAGATGAGAGGAGG + Intergenic
939075416 2:137596746-137596768 ATCTTGAAGAAGAAAGGAGGAGG - Intronic
939475436 2:142680701-142680723 CAGTTGCAGGAGAAAGGAAGGGG - Intergenic
939645719 2:144696443-144696465 CAGTTGGAGAAGAAGAAAGCAGG + Intergenic
940487038 2:154309266-154309288 AAGGTGGAAAAGAAAGGAGTTGG - Intronic
940653625 2:156461893-156461915 CAAGTGAAGAAGACAGGAGGAGG - Intronic
942023367 2:171889084-171889106 CAATTGAAGTAGGAAGGAGGAGG - Intronic
942128120 2:172847613-172847635 CATGTGGAGAAGAAAGCAGGTGG + Intronic
942420596 2:175803094-175803116 CTGTTGAAGAAGGAAGGAGGGGG + Intergenic
942524801 2:176841779-176841801 AAGGTGGAGAAGGAAGGAGGAGG - Intergenic
942844937 2:180412923-180412945 CACTTGGAAAAGGAATGAGGTGG + Intergenic
943058486 2:183012921-183012943 AAGATGGATAAGAAAGTAGGGGG - Intronic
943188149 2:184640252-184640274 GAGAAGAAGAAGAAAGGAGGAGG + Intronic
943335331 2:186606600-186606622 AAGTTGGGGAAGAAAGGAAAAGG - Intronic
943588988 2:189774737-189774759 AAGCTGGGGAAAAAAGGAGGAGG + Intronic
944170418 2:196770368-196770390 TAGTTTGAAAAGAATGGAGGAGG + Intronic
944402559 2:199345061-199345083 CAGGTGGAGAAGGAAGAAGAGGG - Intronic
944689945 2:202149660-202149682 GAGTGGGAGAAGTAATGAGGAGG + Intronic
945020170 2:205562839-205562861 GAGTCAGAGAAGACAGGAGGAGG - Intronic
946639408 2:221767284-221767306 AAGTTCGGGAAGAAGGGAGGAGG + Intergenic
946679893 2:222202382-222202404 CAGTTGCAGAAGAAGGAAAGGGG + Intronic
947094448 2:226550249-226550271 CAGGTGGAGAAGACAGGGGGAGG + Intergenic
947330892 2:229028063-229028085 CAGTGGGAAAGGACAGGAGGAGG + Intronic
947454668 2:230243059-230243081 AAGCTGGAGAAGTAAGCAGGTGG - Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948152365 2:235754520-235754542 ATGTTGGAGAAGAAAGAATGAGG - Intronic
948530326 2:238599940-238599962 CAGTGTGAGAAGGCAGGAGGGGG - Intergenic
948748231 2:240110864-240110886 GAGGAGGAGAAGAGAGGAGGAGG - Intergenic
948926052 2:241098905-241098927 CATTTTGAGAGGGAAGGAGGAGG - Intronic
1169521970 20:6384006-6384028 CAAATAGAGAAGAAAGGAGTAGG + Intergenic
1169560493 20:6794808-6794830 AAGTTGAAGAAGAAGGGAGTGGG - Intergenic
1169807816 20:9577428-9577450 CAGATGAAGCAGAAATGAGGAGG - Intronic
1171094623 20:22319520-22319542 CAGGAGGAGAACAAAAGAGGAGG + Intergenic
1171178440 20:23073381-23073403 CAGTAGGAGAGGAAGGGAAGTGG - Intergenic
1172211589 20:33202570-33202592 CGTTTGGAGAAGAATGTAGGTGG + Intergenic
1172455198 20:35065972-35065994 CAGTTAAAGAAGAAAGGCTGTGG + Intronic
1172538905 20:35696139-35696161 CAGTTGGATAGCAAAGGAGGTGG - Intronic
1172623095 20:36332306-36332328 CAAAAGGAGAGGAAAGGAGGGGG - Intronic
1172887879 20:38243783-38243805 CAGATGGAGAAACAAGGAAGTGG + Intronic
1173674528 20:44822231-44822253 GATTTGGAGAAGAAAGTAGCAGG + Intergenic
1174397995 20:50259790-50259812 CAGGAGAGGAAGAAAGGAGGAGG - Intergenic
1174748265 20:53086007-53086029 CAGATGGAGAAGTCAGGATGAGG - Intronic
1175189477 20:57201552-57201574 CAGCTGGAGAAGAAAGTGGGAGG + Intronic
1175231901 20:57479223-57479245 AAATTAGGGAAGAAAGGAGGAGG - Intergenic
1175417574 20:58811874-58811896 CATTTGTAAAATAAAGGAGGTGG - Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1175978567 20:62725789-62725811 GAGAGGGAGAAGAAGGGAGGTGG + Intronic
1176105789 20:63385553-63385575 AAGCTGCAGAAGAAAAGAGGAGG + Intergenic
1176986501 21:15443532-15443554 AAGTTGGAGAAGAAAGAAAAGGG + Intergenic
1177753912 21:25321628-25321650 CTGTAGGAAAAGAAAAGAGGAGG - Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178490852 21:33050608-33050630 CATAAGGAGAAGGAAGGAGGTGG - Intergenic
1179038239 21:37778819-37778841 CAGAGGCAGAAGGAAGGAGGGGG - Intronic
1179419939 21:41227406-41227428 TAGTTGGGGACAAAAGGAGGGGG + Intronic
1180205060 21:46254685-46254707 CAGTTGGAGATGCATGAAGGGGG + Intronic
1181405192 22:22679507-22679529 CAGCTGTGGGAGAAAGGAGGAGG - Intergenic
1181552034 22:23645362-23645384 CAGGTGGGGAGGGAAGGAGGGGG - Intergenic
1181856953 22:25788713-25788735 TAGGAGGAGAAGGAAGGAGGAGG - Intronic
1181868832 22:25881672-25881694 CACTTGGAGAAGGAAGGGTGGGG + Intronic
1181883413 22:25999632-25999654 GAGAAGGAGGAGAAAGGAGGAGG - Intronic
1182118924 22:27774484-27774506 CAGTGGGAGCTGAAAGCAGGAGG - Intronic
1182654628 22:31880206-31880228 CATTTGGGGAGGAAAGGAAGAGG - Intronic
1183131426 22:35840413-35840435 GAGCTGGAGAAAGAAGGAGGGGG - Intronic
1183319101 22:37154264-37154286 CAGATGGAGAGGCAGGGAGGGGG + Intronic
1183437126 22:37802717-37802739 GAGTTGGAGGGGAAGGGAGGGGG - Intergenic
1183613101 22:38923849-38923871 GAGTGAGGGAAGAAAGGAGGAGG - Intergenic
1183782472 22:40007581-40007603 GAGGAGGAGAAGAGAGGAGGAGG - Intronic
1184452165 22:44589720-44589742 CAGAAGGAGGAGAGAGGAGGAGG + Intergenic
1184799522 22:46751285-46751307 GAGCTGGAGAAGGAGGGAGGAGG - Intergenic
1184928774 22:47664051-47664073 TGGTTGGAGAAGAAGGAAGGTGG - Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
1185364677 22:50432007-50432029 GAGTTGGAGGAGAAGGGAGAGGG + Intronic
950096625 3:10334420-10334442 GAGTTGGTGCAGAAAGGAGCTGG + Intronic
950466409 3:13157782-13157804 CAGAGGGAGAAGAAAGGAAATGG + Intergenic
950654507 3:14428196-14428218 CAGTTGGAATAGAAGGGAGGGGG + Intronic
950759481 3:15207729-15207751 CAGTGGGACAAGATTGGAGGTGG - Intronic
951436412 3:22670338-22670360 CAGTTGGGTAAAAAAGGAGAAGG - Intergenic
951439299 3:22704808-22704830 GAGTAGGAGAAGAAAGGAAGAGG - Intergenic
951439429 3:22706515-22706537 AAGGGGGAGAAGAAAGGAAGAGG + Intergenic
955136610 3:56225165-56225187 CAAATGGGGAAAAAAGGAGGGGG - Intronic
956190401 3:66602311-66602333 CATTTATAGTAGAAAGGAGGAGG - Intergenic
956705731 3:71997445-71997467 AAGAAGAAGAAGAAAGGAGGAGG + Intergenic
956968702 3:74495134-74495156 CAGCTGGAGAAGCCAGGATGTGG + Intronic
957315084 3:78566582-78566604 GAGTGAGAGAAGAAAGGAGAGGG - Intergenic
957597512 3:82287324-82287346 TAGTTGAAGAAGAAAGAAGGTGG + Intergenic
957894140 3:86398384-86398406 GAGAAGGAGAAGAAGGGAGGAGG + Intergenic
958962531 3:100523673-100523695 GAGAAGGAGGAGAAAGGAGGGGG - Intronic
958962540 3:100523704-100523726 GAGAAGGAGGAGAAAGGAGGAGG - Intronic
958962545 3:100523726-100523748 GAGAAGGAGGAGAAAGGAGGAGG - Intronic
959628458 3:108480886-108480908 CAGATGGAGAAGAAGGAACGGGG - Intronic
959668481 3:108947982-108948004 CCGTTTGAGAAGGAAGAAGGGGG - Intronic
959926825 3:111931482-111931504 GAGTCAGAGAAGAAAGGAGAAGG - Intronic
960173965 3:114495721-114495743 CACTAGGAAAAGAAATGAGGAGG + Intronic
960366555 3:116779768-116779790 CAGTTGATTAAGAAAGGAAGGGG + Intronic
960725218 3:120663178-120663200 GAGAAGGAGAAGAAAAGAGGAGG + Intronic
961217255 3:125169360-125169382 CAGGAGGTGAAGAAAGGAAGAGG + Intronic
961340683 3:126215390-126215412 CATTTTGAGAAGAAAGGTGAAGG - Intergenic
961368813 3:126417520-126417542 CAGTTGGAGAGGCAGGCAGGGGG + Intronic
961476968 3:127153058-127153080 CATCTGGAGCAGAGAGGAGGTGG + Intergenic
961848903 3:129794914-129794936 CAGTGTGAAAAAAAAGGAGGTGG + Intronic
961951010 3:130749077-130749099 GAGATGGAGAAGAAGGGAGGAGG - Intergenic
961979647 3:131063483-131063505 CAGATGTAGTAGAAAGGAAGGGG + Intronic
961995427 3:131237035-131237057 AACTTGGAGAAAAAAGTAGGTGG + Intronic
962030067 3:131590186-131590208 GACTTGGAGAATAAAGGAGAGGG + Intronic
962406087 3:135101278-135101300 CAAAGGGAGAAGAAAAGAGGTGG - Intronic
962435975 3:135367024-135367046 CAGTTGGGGGTGAAAGAAGGAGG + Intergenic
962603087 3:137010142-137010164 CAGCTGCAGAAGGGAGGAGGTGG + Exonic
962723940 3:138203556-138203578 CTGTTAGAGAAAAAGGGAGGGGG + Intronic
963711816 3:148755206-148755228 GAGCAGGAGAAGAAAGGAGAAGG - Intergenic
963825567 3:149949628-149949650 CAGAAGGAGAAGAAAGAAAGGGG - Intronic
963888588 3:150607963-150607985 AACTTGGAAAAGTAAGGAGGTGG + Intronic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
964832663 3:160902447-160902469 CAGGTGGAGAAGAAATGGGCAGG + Intronic
965075836 3:163974343-163974365 CACTTGGGTAAGTAAGGAGGTGG - Intergenic
965475590 3:169150908-169150930 CAGCTGGGGAAGGAAGGAAGGGG - Intronic
965559031 3:170044498-170044520 CAGTTTGACAAGAATGGAGTAGG + Intronic
965680674 3:171248120-171248142 GAGTTTGAGAAGAAAGGCAGAGG + Intronic
965845732 3:172959177-172959199 CAGTTGGAAAAGAAATGGGGTGG - Intronic
966248907 3:177839902-177839924 GAGTTTCAGAAGAAAGGATGAGG - Intergenic
966772072 3:183512924-183512946 CAATTGGAGAGGATAGGAAGTGG - Intronic
967220190 3:187242102-187242124 CAAATGGAGAAGAAAGGAAAGGG - Intronic
967299524 3:187999011-187999033 CACATGGAAAAGAAAGGAGAAGG + Intergenic
967403561 3:189091208-189091230 CACTGGAAGAAGAAAGGGGGTGG - Intronic
967788117 3:193519356-193519378 GAGTTGGAGAGGAAGGCAGGTGG - Intronic
968054399 3:195680484-195680506 TAGAGGGAGAAGCAAGGAGGAGG + Intergenic
968101492 3:195968674-195968696 TAGAGGGAGAAGCAAGGAGGAGG - Intergenic
968752588 4:2397989-2398011 GAGATGGAGGAGAATGGAGGGGG + Intronic
968819870 4:2842848-2842870 CAGTTGAAGAAGCAGGGAGTTGG - Intergenic
969116026 4:4871390-4871412 CACTTGGAGGAGAAAGATGGGGG + Intergenic
969246123 4:5934015-5934037 CAGTTTTAGAAGAAAAGAGTAGG - Intronic
970219690 4:13797972-13797994 AAGAAGGAGAAGAAAGAAGGAGG + Intergenic
970501218 4:16679281-16679303 AAGTGAGAGAAGAAAGGAGGAGG + Intronic
970605014 4:17671362-17671384 CACTTGGAAGAGAATGGAGGTGG + Intronic
971035443 4:22688025-22688047 TCATTGGAGAAGAAAGGAAGTGG - Intergenic
971510400 4:27417048-27417070 CATTTGGATAAGTAATGAGGAGG + Intergenic
971514649 4:27471248-27471270 AAGTAGCAGAAGACAGGAGGTGG + Intergenic
972169214 4:36324278-36324300 GAGTTGAAGGAGGAAGGAGGAGG - Intronic
972662588 4:41130606-41130628 TAGTTAGAAAGGAAAGGAGGGGG - Intronic
973306686 4:48659957-48659979 AAGAAGAAGAAGAAAGGAGGAGG + Intronic
973690092 4:53419317-53419339 CTGTTGAAGAAGAAGGGAAGGGG + Intronic
974328940 4:60451219-60451241 AAGTTGGGGAAGAAAGAAGCTGG - Intergenic
974940269 4:68459856-68459878 CTGTTACAGAAGAAAGGAGATGG - Intronic
975183013 4:71369011-71369033 CAGAAGCAGAAGACAGGAGGAGG - Intronic
977083201 4:92560156-92560178 AATGTGGAGAAGAAAGGAGAGGG + Intronic
978848276 4:113301634-113301656 GTGTTGGAGAAGGAAGGGGGAGG - Intronic
979091989 4:116495057-116495079 CAGTTGGAAAACCAAGGATGTGG - Intergenic
979733382 4:124052417-124052439 AAGAGGGTGAAGAAAGGAGGAGG + Intergenic
979807538 4:124993375-124993397 CAGTTGGAGAGGAAAGTAGGTGG + Intergenic
981171024 4:141623591-141623613 TAGGTGGGGAGGAAAGGAGGCGG - Intergenic
981499537 4:145435287-145435309 CAGCTGGAGAAGGGAGGAGAAGG - Intergenic
982139928 4:152307568-152307590 GAGCTGGAGAAGCAGGGAGGGGG + Intergenic
982611980 4:157586313-157586335 AAAAGGGAGAAGAAAGGAGGAGG - Intergenic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
983208177 4:164932645-164932667 GAGTAGGAGAAGAAAAGGGGAGG - Intergenic
983648866 4:170019162-170019184 CCTTTGGAGAAGAAAGGAGTTGG + Intronic
983804198 4:171973236-171973258 CTTTTGGAGAAAAAAGGAGGAGG + Intronic
984844729 4:184099699-184099721 CAGCTGGAGAAGGAGGGACGAGG - Intronic
985501467 5:250282-250304 TAGAGGGAGAAGCAAGGAGGAGG + Intronic
985735415 5:1577352-1577374 TAGAGGGAGAAGCAAGGAGGAGG - Intergenic
986964895 5:13258361-13258383 GAGTTGGAGAAAAATGGAGAAGG - Intergenic
987163448 5:15169360-15169382 GATTTGGAGAAAAATGGAGGGGG - Intergenic
988999129 5:36742897-36742919 AAGCTGGAGAAGAAAGGAAATGG + Intergenic
989181008 5:38577170-38577192 CAGGATGAGAAGAAAGGAGAGGG - Intronic
990488315 5:56280301-56280323 CAGAAGGAGAAGGGAGGAGGTGG + Intergenic
990549145 5:56855129-56855151 AAGGCAGAGAAGAAAGGAGGAGG - Intronic
991431762 5:66555456-66555478 CAGGTGGAGGAGAAAGACGGGGG - Intergenic
991968451 5:72114749-72114771 CAGTGGGAGGAGGAAGGAAGAGG + Intronic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992877965 5:81076479-81076501 GAGTTGGAGAAGAGAGAAAGAGG + Intronic
992877987 5:81076606-81076628 GAGTTGGAGAAGAGAGAAAGAGG + Intronic
994849068 5:105030174-105030196 TATTAGGAGAAGAAAGAAGGAGG - Intergenic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
995777301 5:115737650-115737672 AAGTTGATGAAGAAAGGAAGTGG - Intergenic
996127538 5:119744008-119744030 AAGAAGAAGAAGAAAGGAGGAGG + Intergenic
996833024 5:127760558-127760580 CAGTTGGAGAACACAGGACAAGG - Intergenic
997425323 5:133799044-133799066 AAGGTAGAGAGGAAAGGAGGTGG + Intergenic
998426572 5:142033915-142033937 CAGATGGGGAAGAAACGAAGAGG + Intergenic
998997328 5:147879952-147879974 AAGTGGCAGCAGAAAGGAGGTGG + Intronic
999298240 5:150474063-150474085 GAGTTGCAGAAGAAGGGAGGTGG + Intergenic
999360685 5:150984104-150984126 CAGTGGAAGAACAAAGGAAGAGG - Intergenic
999450827 5:151676786-151676808 CAGAGGGAGTAGGAAGGAGGGGG - Intronic
999660387 5:153856519-153856541 CAGCCAGAGAAGAAGGGAGGAGG - Intergenic
999731908 5:154481545-154481567 CAGTTGCAGAAGAAGGGAATAGG + Intergenic
999833327 5:155341627-155341649 CAGCTGAAGAAGAAAGGGTGGGG + Intergenic
1001960596 5:175878499-175878521 CTGCTGGAGGAGAAAGGAGATGG - Intronic
1002164648 5:177336842-177336864 CATTTACAGAAGAAAGGAGGAGG + Intronic
1002164662 5:177336918-177336940 CATTTACAGAAGAAAGGAGGAGG + Intronic
1002164678 5:177336994-177337016 CATTTACAGAAGAAAGGAGGAGG + Intronic
1002820253 6:718090-718112 GAGATGGAGAAGACTGGAGGAGG + Intergenic
1002940446 6:1710997-1711019 GGGCTGGAGAAGAAAGGAGCCGG + Intronic
1002992410 6:2250059-2250081 CAGTTGGACCAGAAAGCAGAAGG - Intergenic
1003171492 6:3724883-3724905 CATTTGGATAAGAAAGGCTGAGG + Intronic
1003197311 6:3926251-3926273 CAGGAGGAGGAGAAAGCAGGAGG + Intergenic
1003318507 6:5032898-5032920 CAGGAGGAGGAGAAAGCAGGAGG - Intergenic
1003561395 6:7183683-7183705 TCCCTGGAGAAGAAAGGAGGGGG - Intronic
1003879966 6:10471054-10471076 CAGCAGGAGAAGAAAGGCTGTGG - Intergenic
1003888813 6:10545127-10545149 CAGTTTTATTAGAAAGGAGGGGG - Intronic
1004215510 6:13700383-13700405 CGGCTGGAGCAGAAAGGAGGTGG - Intronic
1004288415 6:14344651-14344673 CTGATGGAGAAGAAAGGAAGGGG + Intergenic
1004494234 6:16148620-16148642 CTATTGGAGAAGGAAGGAAGTGG + Intergenic
1004507395 6:16258162-16258184 GAGATGGAGAAGAAAGATGGAGG + Intronic
1005283891 6:24303459-24303481 CAGTAGGTGGAGAAATGAGGAGG - Intronic
1005647757 6:27857374-27857396 GAGAGAGAGAAGAAAGGAGGAGG + Intronic
1005826191 6:29632923-29632945 AAGGTGGAGGAGAAGGGAGGGGG - Exonic
1005968509 6:30743480-30743502 AAGTAGGAGAAGAAATGGGGAGG - Exonic
1006174317 6:32112744-32112766 GAGTGGGGGAAGGAAGGAGGAGG + Intronic
1006455971 6:34132148-34132170 CAGGAAGAGAGGAAAGGAGGCGG + Intronic
1006599876 6:35218325-35218347 TAGTTGGAGAAGTAAAGAAGTGG + Intronic
1007121362 6:39384819-39384841 TAGCTGGAGAGGAAATGAGGAGG + Intronic
1007126930 6:39433286-39433308 CCGTGGGAGCAGAAAGGACGTGG + Intronic
1007139241 6:39554831-39554853 CAGATGGAGAAAGATGGAGGAGG - Intronic
1007558661 6:42787259-42787281 TGGTTGGAGAAGACTGGAGGAGG + Intronic
1008007660 6:46428825-46428847 CATTTTGAGAAGAAAGCAGATGG - Intronic
1008045309 6:46845601-46845623 CATTTGGAGAAGAAAAGGGTTGG + Intergenic
1009993132 6:70868477-70868499 TAGTTGGAGAAGAGAGAATGTGG - Intronic
1010753837 6:79644269-79644291 GAGAGGGAGTAGAAAGGAGGAGG + Intronic
1010802743 6:80196721-80196743 AACTGGGAGAAAAAAGGAGGAGG + Intronic
1010840782 6:80647443-80647465 GAGTTGTAGAAGACAGAAGGAGG + Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011743382 6:90386098-90386120 GAGGGGGAGAAGAAAGCAGGGGG - Intergenic
1012019527 6:93900139-93900161 GAGTGGAAGGAGAAAGGAGGAGG + Intergenic
1012628989 6:101440120-101440142 CAGTTGTAGAAAAAATGATGGGG + Intronic
1012976156 6:105783235-105783257 CAGAAGTAGAAGAAAGAAGGAGG + Intergenic
1013356626 6:109351020-109351042 AAGTGGGAGATGAAAGGATGAGG - Intergenic
1013679932 6:112513888-112513910 TAGTTGGAGCAGAAAGCAAGAGG + Intergenic
1015101327 6:129484800-129484822 GAGATGGAGAAGCAAGGAGATGG + Intronic
1015161914 6:130162273-130162295 CAGCTGGAGCAGAAATAAGGAGG + Intronic
1015365105 6:132388561-132388583 TAGTTGCAGAAGGGAGGAGGAGG - Intronic
1016161309 6:140883954-140883976 AAGAGGGAGGAGAAAGGAGGAGG - Intergenic
1016302402 6:142646817-142646839 CAGTTTGAGAATTAAGGTGGGGG - Intergenic
1016429408 6:143966811-143966833 CAGTGGGGGATGAAGGGAGGCGG - Intronic
1016459763 6:144270133-144270155 CACTTTGAGAGGCAAGGAGGGGG - Intergenic
1017546182 6:155452803-155452825 CTGATGAGGAAGAAAGGAGGAGG - Intronic
1017598170 6:156052667-156052689 CAGTTGATGAATAAATGAGGTGG - Intergenic
1017757431 6:157541479-157541501 GAGCTGGAGAAGAAAGGATTGGG - Intronic
1018007271 6:159634081-159634103 CATTTGAAGAAGAAAGAATGCGG - Intergenic
1018188845 6:161291311-161291333 CAGATGGAGAAGCAAGGCTGAGG - Intergenic
1019009715 6:168834283-168834305 CAGTTGGAGAGGAAGAGAGCAGG + Intergenic
1019266764 7:121525-121547 GAGGTGGAGAGGAAGGGAGGAGG + Intergenic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1019773971 7:2901451-2901473 CAGATGGAGAGGAGAGGAGAGGG + Intergenic
1019816366 7:3204045-3204067 CAGGAGGAGGAGAGAGGAGGAGG + Intergenic
1019963012 7:4476971-4476993 GAGAGGGAGAAGAAAGGAGAAGG + Intergenic
1021245064 7:18251351-18251373 CTGTTGGAGAAGAGTGGTGGGGG + Intronic
1021901847 7:25293339-25293361 CAGTTGGAGGTCATAGGAGGAGG - Intergenic
1022361617 7:29665137-29665159 CAGTGGGAGAGGAAAGGATGAGG + Intergenic
1022636348 7:32139747-32139769 CAGCTGGAGAAGGAAGGATGTGG + Intronic
1022699769 7:32748584-32748606 CAGTGGGAGAGGAAAGGATGAGG - Intergenic
1022802053 7:33786148-33786170 GAGCAGGAGAAGAGAGGAGGAGG + Intergenic
1022935726 7:35174297-35174319 CAGTGGGAGAGGAAAGGATGAGG - Intergenic
1024049125 7:45607402-45607424 CAGCAGGAGAAGAAGGGAAGAGG + Intronic
1025872160 7:65444955-65444977 CAATGGGAGAAGAAAGGAGACGG - Intergenic
1025940400 7:66072739-66072761 CTGTGGGAGAAGACAGGAGAGGG + Intergenic
1026434452 7:70383183-70383205 CAGTAGAAGATGAGAGGAGGAGG + Intronic
1026567353 7:71500607-71500629 CAGTGGGACAAGCAAGGAAGTGG - Intronic
1026658791 7:72280527-72280549 AACTTGGAGAAAAAAGGAGGTGG - Intronic
1027164588 7:75825413-75825435 CAGGTGGAAAAGGAAGCAGGGGG + Intergenic
1027571266 7:79870262-79870284 CGGCTGGAGCAGAAAGAAGGAGG + Intergenic
1027645315 7:80790317-80790339 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1028034022 7:85956614-85956636 CACTTTGAGAAGAAAAGAAGAGG - Intergenic
1028748409 7:94354361-94354383 CAGTTGGAGATGAGAGGGAGTGG - Intergenic
1029189331 7:98760714-98760736 CAGTTGGAGAGGACAGAAGGAGG + Intergenic
1029225394 7:99023578-99023600 CAGAAAGAGAAGAAAGGAAGAGG + Intergenic
1029831678 7:103267035-103267057 CAGTGGGAGAGGAAGGGATGAGG - Intergenic
1030069514 7:105686896-105686918 GAGTTGGCCCAGAAAGGAGGTGG + Intronic
1030198955 7:106882448-106882470 GAGATGGAGAAGGAAAGAGGAGG - Intronic
1030327057 7:108230806-108230828 CAGTGGGAGGAGATAGGAGTGGG - Intronic
1030614941 7:111729261-111729283 CAGATAGAGGAGAAAGGAGCTGG + Intronic
1032085084 7:128879621-128879643 CACCTGGAGGATAAAGGAGGTGG + Exonic
1032125559 7:129189872-129189894 GAGTTGGAGAGGAAAAGGGGAGG + Intronic
1032321010 7:130886748-130886770 CAGTAGGAGAAGCAAAGAGAAGG - Intergenic
1032466821 7:132151358-132151380 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466826 7:132151377-132151399 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466849 7:132151459-132151481 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466859 7:132151500-132151522 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466863 7:132151516-132151538 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466867 7:132151532-132151554 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466871 7:132151548-132151570 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032466875 7:132151564-132151586 GAGGAGGAGGAGAAAGGAGGAGG + Intronic
1032473071 7:132192384-132192406 CAGTTGAAGAAGGAAGAAGGAGG + Intronic
1032523311 7:132562087-132562109 GAGGAGGAGGAGAAAGGAGGAGG - Intronic
1032523391 7:132562461-132562483 AAGGAGGAGGAGAAAGGAGGAGG - Intronic
1032832837 7:135645851-135645873 CAGCTCTAGAAGAATGGAGGAGG + Intronic
1033397669 7:140991319-140991341 CAGTTGGAGAAGAGCTGGGGGGG + Intergenic
1033473445 7:141668743-141668765 CCCTTTTAGAAGAAAGGAGGTGG - Intronic
1033898171 7:146101575-146101597 CAGATGGGGAGGCAAGGAGGGGG - Intergenic
1034378257 7:150665548-150665570 AAGTTGGAGAAGCTGGGAGGTGG + Intergenic
1034641739 7:152609430-152609452 CAGCTGGAAAAAAAAGGAGCAGG + Intergenic
1034738559 7:153452332-153452354 CAGCTAGAGGAGAAAGGTGGAGG + Intergenic
1034758657 7:153649474-153649496 CAGATAGGGAAGAGAGGAGGAGG + Intergenic
1035284728 7:157799010-157799032 AAGTTGGAGAAGAAAGGAGGAGG - Intronic
1035370862 7:158378088-158378110 CAGCTGGAGGAGTCAGGAGGAGG - Intronic
1035610709 8:962266-962288 CAGATGGCGAAGTAAGGAGAGGG + Intergenic
1036138057 8:6180474-6180496 AAGGTGGAGAAGACAGCAGGGGG + Intergenic
1037531330 8:19777150-19777172 CATATGGAGAAGAAAGTATGAGG + Intergenic
1037898509 8:22674045-22674067 GAGATGGAGAAGAAGGGAGAAGG - Intergenic
1037906382 8:22718269-22718291 CAGCTGCAGAAGGGAGGAGGAGG - Intronic
1037936834 8:22920530-22920552 CAGTGTGAGAAGAAAAGTGGCGG + Intronic
1038395116 8:27240982-27241004 GAGGTGGAGAAGACAGGTGGTGG - Intronic
1039016099 8:33150657-33150679 CAGTGAGGGAAGAAAGGAAGGGG + Intergenic
1039715730 8:40106766-40106788 CAGTTGGAGCAGGAAGAAAGTGG + Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1040876528 8:52158205-52158227 CAATTGGGGAGGAAAGGAGAGGG + Intronic
1041291161 8:56310107-56310129 GAGGAGGAGAAGGAAGGAGGAGG + Intronic
1041370480 8:57154610-57154632 CAGTGGGATAAGGAGGGAGGGGG - Intergenic
1042917948 8:73893824-73893846 CAGTTTAAGAAGCAGGGAGGGGG + Intergenic
1042975745 8:74467183-74467205 AAGTTTGAGGAGAAAGGAGAAGG + Intronic
1043462176 8:80471345-80471367 AAGTTTGAAAAGAAAGGAAGGGG - Intergenic
1043626766 8:82271443-82271465 CAGTGAGAGAAGAAAGGTGTGGG - Intergenic
1043860583 8:85311716-85311738 GAGTTGGACAAGATGGGAGGAGG - Intergenic
1044050482 8:87496203-87496225 AAGTTGGAGAAGAAAAAAGTTGG - Intronic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044160895 8:88913737-88913759 AAGATGGAGAGGAGAGGAGGTGG - Intergenic
1044414687 8:91924012-91924034 CAGTGGGACAAGATTGGAGGTGG + Intergenic
1044426932 8:92062751-92062773 CACTTGGAGCAGAAATGTGGAGG + Intronic
1044823381 8:96174075-96174097 CAGTCTGTGAAGAAAGAAGGGGG - Intergenic
1045195967 8:99930867-99930889 CAGTTGGAGAAGAAAAGGGAAGG + Intergenic
1045218852 8:100176916-100176938 GAGAGGGAGAGGAAAGGAGGAGG - Intronic
1046105099 8:109655647-109655669 AAGTGGTAGAAGAAAGCAGGAGG - Intronic
1046361794 8:113169033-113169055 TAGTTGGAGAAGAAAGAAGTAGG - Intronic
1046612888 8:116445254-116445276 CAGGAGGAGGAGAGAGGAGGGGG + Intergenic
1046737562 8:117793467-117793489 AAGTTGGAGAACAAATGAGAAGG - Intergenic
1046815554 8:118579626-118579648 TATTTGGAGGAGAAGGGAGGTGG + Intronic
1047367314 8:124223232-124223254 GAGTTGGGGAAGGAAGAAGGGGG + Intergenic
1047966179 8:130048544-130048566 CAGATGGAGCAGACAGGAGAAGG - Intergenic
1048189914 8:132278615-132278637 CACTTGGAGTAGTAAGAAGGTGG - Intronic
1048478050 8:134760769-134760791 TAATTGGTGAAGGAAGGAGGGGG + Intergenic
1048982119 8:139708210-139708232 CAGGTGGAGAAGAGAAGGGGAGG - Intergenic
1049022432 8:139966632-139966654 CAGTGGGATTAGAAAGGAGCTGG - Intronic
1049121945 8:140747428-140747450 GAGGAGGAGAAGAAAGGGGGGGG + Intronic
1049248904 8:141577753-141577775 CATTTAGAGAAGGAAGGTGGAGG + Intergenic
1049353801 8:142177918-142177940 CTGTTGGAGGAGGAAGGAGGAGG + Intergenic
1050213065 9:3286771-3286793 CAGAAGGAGAATCAAGGAGGTGG - Intronic
1050475909 9:6040919-6040941 AAGATGAAGAAGTAAGGAGGAGG - Intergenic
1050907983 9:11028681-11028703 AAGTTGGAGTAGAAATGAGATGG - Intergenic
1051270562 9:15351173-15351195 CTGTTGGAGGAGAGAGGATGTGG + Intergenic
1051319604 9:15887898-15887920 AAGATGGAGAACAGAGGAGGAGG - Intronic
1051519539 9:17970290-17970312 CAGTTGGGGTAGATAGGAGGGGG - Intergenic
1053263604 9:36693995-36694017 GAGAAGGAGGAGAAAGGAGGAGG - Intergenic
1053383945 9:37672236-37672258 CAGTTGGAGAAGCCAGCAGCAGG + Intronic
1053562394 9:39209864-39209886 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053615514 9:39761633-39761655 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1053828200 9:42047856-42047878 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053873679 9:42520896-42520918 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1054134757 9:61409175-61409197 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1054238006 9:62580758-62580780 CAGTGGGAAAAGAAAGTTGGAGG - Intergenic
1054262578 9:62882567-62882589 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1054268653 9:62945860-62945882 CAGTGGGAAAAGAAAGTTGGAGG - Intergenic
1054552137 9:66615268-66615290 CAGTGGGAAAAGAAAGTTGGAGG - Intergenic
1054602359 9:67139598-67139620 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1055070642 9:72162527-72162549 CAGGTGGCAAAGAATGGAGGAGG + Intronic
1055550067 9:77425213-77425235 CTGAGGGAGCAGAAAGGAGGAGG + Intronic
1055577097 9:77671305-77671327 GAGCTGGAGAAGAATGAAGGAGG + Intergenic
1055608658 9:77998025-77998047 GAAGTGGGGAAGAAAGGAGGAGG - Intronic
1056122347 9:83501915-83501937 GAGTTGCAGCAGAAAGGAGGAGG - Intronic
1056530066 9:87479003-87479025 GAGATGGAGAAGACAGGAGACGG + Intergenic
1056672247 9:88640181-88640203 CAGCTGGAGGAGAGAGGAGGAGG + Intergenic
1056863698 9:90210853-90210875 CACATGGAGAAGAATGAAGGTGG + Intergenic
1057514967 9:95713087-95713109 CAGTTAGAAAAGAAAGCAGGAGG - Intergenic
1058268980 9:102945346-102945368 CAGAAGGAGAAGAAAGGAGCAGG - Intergenic
1058561436 9:106233145-106233167 AAGAAGGAGGAGAAAGGAGGAGG - Intergenic
1058618552 9:106861048-106861070 GCGGTGGAGAAGAAAGGAGGGGG - Intergenic
1058875855 9:109244309-109244331 GAGTTTGAGAAGAAGGGATGAGG + Intronic
1059061069 9:111036489-111036511 CAGTAGGAAAAGGTAGGAGGGGG - Intronic
1059072408 9:111152761-111152783 GAGGAGGAGGAGAAAGGAGGAGG + Intergenic
1059072460 9:111152949-111152971 CAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1059349611 9:113655185-113655207 CAGGTGAAGAGGAAGGGAGGTGG - Intergenic
1059415044 9:114157001-114157023 GACATGGGGAAGAAAGGAGGGGG - Intronic
1059659048 9:116383176-116383198 CAGTCGGAGAAAAATGGAGGTGG - Intronic
1059842114 9:118229432-118229454 GAGTTGGGGAAGGAAGCAGGAGG + Intergenic
1059952886 9:119485792-119485814 CAGGTAGAGAAGAAAGGAAAAGG - Intergenic
1059969512 9:119650871-119650893 CAGGTGGAGAACAAGGCAGGAGG + Intergenic
1060115981 9:120941190-120941212 CAGCTGGAGAAGACAGGAGAAGG - Intergenic
1060300352 9:122371334-122371356 CCGCTGGAGGGGAAAGGAGGGGG - Intronic
1060677853 9:125532441-125532463 CAGTTGCAAAAGAGATGAGGGGG + Intronic
1061259397 9:129471505-129471527 CAGTCAGAGAAGACAGCAGGAGG - Intergenic
1061611533 9:131749847-131749869 AATTGTGAGAAGAAAGGAGGTGG - Intergenic
1061810142 9:133157643-133157665 TGGTTGGAGAAGAAAGAAGGGGG + Intronic
1062210957 9:135363776-135363798 CACTTGGAAAAGAAAGAGGGAGG - Intergenic
1185661981 X:1735376-1735398 CAGGATAAGAAGAAAGGAGGAGG - Intergenic
1186508168 X:10110431-10110453 AAGTTGGAGAGGAAAGCAGTAGG - Intronic
1186666620 X:11723429-11723451 CGCTTGGAAAAGAAAGGAGAAGG + Intergenic
1186718144 X:12275242-12275264 CAGGTGGAAAAGAGAGGGGGAGG - Intronic
1186800560 X:13088334-13088356 GAGTTGGAGAAGAGATGGGGTGG - Intergenic
1186917397 X:14238263-14238285 AAATGGGAGAAGAAAGGAAGAGG + Intergenic
1186953398 X:14653565-14653587 GAGTTGATGAAGAAAGGAAGTGG + Intronic
1187185525 X:16981181-16981203 CTGTGGGACAAGAAAGGAGGAGG - Intronic
1189204603 X:39226932-39226954 CAGTTTGAGAAGAAGGGAAAAGG + Intergenic
1189414363 X:40801774-40801796 CAGTTGGAGCACAGAGGAGAAGG + Intergenic
1189845486 X:45132523-45132545 AAGTGAGAGAAGAAGGGAGGAGG + Intergenic
1189920450 X:45897838-45897860 GAGTTAGAGAAGACAGGAGGAGG + Intergenic
1190445075 X:50515696-50515718 CAGTTGAAGCAGAAAAGAGAAGG + Intergenic
1190797223 X:53757229-53757251 CAGCTGTAGCAGGAAGGAGGGGG - Intergenic
1192157232 X:68755731-68755753 GAGATGGAAAAGAAAGGAGTAGG - Intergenic
1192169038 X:68843157-68843179 CTGGTGGAGAAGAAAGGGGGCGG + Intergenic
1192179024 X:68903776-68903798 CAGATGGAGAACAAAGGTGAAGG - Intergenic
1192185166 X:68941753-68941775 GAGAAGGAGGAGAAAGGAGGAGG + Intergenic
1192185179 X:68941824-68941846 GAGAAGGAGGAGAAAGGAGGAGG + Intergenic
1192985970 X:76398686-76398708 CAGTGGGAAAAGAAAGTTGGAGG + Intergenic
1193700284 X:84751703-84751725 CAGTTGGGGTTGAATGGAGGAGG + Intergenic
1193810839 X:86048775-86048797 CACACGGAGACGAAAGGAGGAGG - Intergenic
1195082806 X:101386933-101386955 CAGTTGGAGCATAATGTAGGGGG - Intronic
1195148429 X:102042278-102042300 CAGATGGAGAGGAATGGAAGGGG + Intergenic
1195244661 X:102984551-102984573 CAGCTAGAGAATAAGGGAGGGGG - Intergenic
1195263864 X:103161074-103161096 TAGTTGGAGAAGAGAAGAGAGGG + Intergenic
1195786162 X:108526218-108526240 GAGGTGGAGAAGGAAGGAGCAGG + Intronic
1195874105 X:109520284-109520306 TACTTGGAGCTGAAAGGAGGAGG + Intergenic
1196051144 X:111305782-111305804 CAGTAGGAGAAAAAAGGAGTGGG + Intronic
1196923008 X:120603914-120603936 CAGGAAGAGAAGAATGGAGGGGG - Intronic
1197307192 X:124857576-124857598 CAGTTGGGGGATAAAGGAGTAGG + Intronic
1197430055 X:126351186-126351208 GAGGTGGAGAGAAAAGGAGGAGG + Intergenic
1197906080 X:131427276-131427298 CAGGAGGAGGAGAGAGGAGGAGG - Intergenic
1198039254 X:132833625-132833647 CACTTGGGGAAGTAAGCAGGAGG + Intronic
1198160916 X:134007320-134007342 CAATGGGAGAAGAAAGAAGATGG + Intergenic
1198271649 X:135061376-135061398 CAGTGGGAGCAGCTAGGAGGGGG - Intergenic
1198491092 X:137142336-137142358 AAGTAAGAGAAGAAGGGAGGGGG - Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199657375 X:150009817-150009839 AAGGTAGAGAAGAAAGGAGAAGG + Intergenic
1200250112 X:154548246-154548268 CAGTTGGAGAGGAAGGGATGGGG + Intronic