ID: 1142138269

View in Genome Browser
Species Human (GRCh38)
Location 16:88461279-88461301
Sequence CAAGCATCCTGGTCCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142138269_1142138282 19 Left 1142138269 16:88461279-88461301 CCTGGTGAGGACCAGGATGCTTG 0: 1
1: 0
2: 1
3: 24
4: 150
Right 1142138282 16:88461321-88461343 CCACCCCATCCCCACCGCAGGGG 0: 1
1: 1
2: 7
3: 53
4: 411
1142138269_1142138280 18 Left 1142138269 16:88461279-88461301 CCTGGTGAGGACCAGGATGCTTG 0: 1
1: 0
2: 1
3: 24
4: 150
Right 1142138280 16:88461320-88461342 CCCACCCCATCCCCACCGCAGGG 0: 1
1: 0
2: 8
3: 89
4: 615
1142138269_1142138274 -7 Left 1142138269 16:88461279-88461301 CCTGGTGAGGACCAGGATGCTTG 0: 1
1: 0
2: 1
3: 24
4: 150
Right 1142138274 16:88461295-88461317 ATGCTTGCTGGGGAGTCCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 204
1142138269_1142138278 17 Left 1142138269 16:88461279-88461301 CCTGGTGAGGACCAGGATGCTTG 0: 1
1: 0
2: 1
3: 24
4: 150
Right 1142138278 16:88461319-88461341 TCCCACCCCATCCCCACCGCAGG 0: 1
1: 0
2: 8
3: 104
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142138269 Original CRISPR CAAGCATCCTGGTCCTCACC AGG (reversed) Intronic
900422681 1:2562418-2562440 AAAGCCACCTGATCCTCACCCGG + Intronic
905414695 1:37795734-37795756 CAGGCGTCCTGGTCCTGTCCTGG + Exonic
907800182 1:57757163-57757185 CCAGCAGCATGGACCTCACCTGG - Intronic
910592978 1:88947619-88947641 CAAACATCCAGGACCTCCCCTGG + Intronic
911375180 1:97043625-97043647 CATCCATCCTGGTCTTCACCAGG - Intergenic
912466240 1:109876959-109876981 CAGGCAGCCTGGTCCATACCTGG - Intergenic
914848860 1:151299211-151299233 CAAACTCCCTGGTCCTCACTGGG - Intronic
915543118 1:156581465-156581487 CCAGCATCCAAGCCCTCACCAGG + Exonic
920051681 1:203168174-203168196 GCAGCATCCTCTTCCTCACCAGG + Intronic
1069158273 10:65054858-65054880 CAACCACCCTGGGCCTCTCCTGG - Intergenic
1070311243 10:75275653-75275675 CAGGCAGCCTGGGCCTCACCTGG + Intergenic
1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG + Intergenic
1071437415 10:85660220-85660242 CCAGTATCCTGGTCCTAACTGGG - Intronic
1073810368 10:107146005-107146027 CAAGCATCCTGGTTTTCACAGGG + Intronic
1084290248 11:68160537-68160559 GCAGGATCCTGGTCCTCACTTGG - Intronic
1088468263 11:110165182-110165204 CAAGCCTCCTCTTCCGCACCTGG + Exonic
1090553421 11:127848114-127848136 CTAGCATCATAGGCCTCACCTGG + Intergenic
1091887713 12:4028790-4028812 CAAGCCTCATGCTCCTCATCTGG - Intergenic
1093594117 12:20941146-20941168 CAAGAATCCTGGTTGTCACTGGG + Intergenic
1098598644 12:72303003-72303025 CAAGCATAGTGGTTCTCAACGGG - Intronic
1100163748 12:91892785-91892807 CAAGCACCCTGGTTGTCACATGG - Intergenic
1101966360 12:109284932-109284954 CAAGCTGTCTGGGCCTCACCGGG + Intronic
1103254743 12:119531355-119531377 CCAGCAGCATGGACCTCACCTGG + Intronic
1104980436 12:132570983-132571005 CCAGCATCCTGGTCCCATCCCGG - Intronic
1109279414 13:60338920-60338942 CTAGCAGCATGGGCCTCACCTGG + Intergenic
1109972694 13:69789976-69789998 GAAACATCTTTGTCCTCACCAGG + Intronic
1113517768 13:110915729-110915751 GAAACATCATGGTCCGCACCCGG - Intergenic
1119572483 14:75687932-75687954 CATGCATCCTGGCCCACACTTGG - Intronic
1121271022 14:92638410-92638432 CCAGCATCCAGGGCCTCCCCTGG - Intronic
1123494763 15:20814559-20814581 GCAGCATCCTGGGCCTCCCCTGG - Intergenic
1123551258 15:21383652-21383674 GCAGCATCCTGGGCCTCCCCTGG - Intergenic
1125612030 15:40977876-40977898 CAAGCAGCATGGCCATCACCTGG + Intergenic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1126495170 15:49282153-49282175 CAAGCATCCTGGGGCTCTCAGGG - Intronic
1126562694 15:50060822-50060844 CCAGCATCATTGGCCTCACCTGG - Intronic
1127799072 15:62462332-62462354 CATGTTTCCTGGTCCTCTCCTGG - Intronic
1128468096 15:67929541-67929563 AAAGCATCCTGGTCTTGGCCGGG + Intergenic
1128551109 15:68598564-68598586 CAGGCATGCTGGTGCTCACCAGG - Intronic
1128882379 15:71255678-71255700 CAAGCAGCCTGGTTCCCACCAGG - Intronic
1129607941 15:77033927-77033949 CTGGGATCCAGGTCCTCACCAGG - Intronic
1129782737 15:78284540-78284562 CCAGCAGCCTTGGCCTCACCTGG + Intronic
1131351607 15:91705874-91705896 CAAGGAGCCTGGCCCTCCCCTGG + Intergenic
1202959599 15_KI270727v1_random:110895-110917 GCAGCATCCTGGGCCTCCCCTGG - Intergenic
1132642210 16:983072-983094 CCCGTATCCTGCTCCTCACCTGG + Intronic
1132844547 16:1993785-1993807 CAGGCATCCTTCTCCTCTCCTGG - Exonic
1134943388 16:18306461-18306483 CTACCATCCTGTTCCTCTCCAGG - Intergenic
1137037664 16:35580051-35580073 CGAGGATCCTGGGCCTCTCCAGG - Intergenic
1141490385 16:84368525-84368547 CAAGCCTCCTGGGCCGGACCCGG - Exonic
1142131279 16:88432648-88432670 CAAGCAGCCTGGCCCACAGCTGG + Exonic
1142138269 16:88461279-88461301 CAAGCATCCTGGTCCTCACCAGG - Intronic
1143620379 17:8076939-8076961 CAGGCATCATGGCCCTCACCTGG - Intronic
1144496379 17:15748827-15748849 CAACCACCCTGGGCCTCTCCTGG + Intronic
1144605964 17:16666231-16666253 CAACCATCCTGGGCCTCTCCTGG + Intergenic
1144791216 17:17860434-17860456 CATCCATGCTGGTCTTCACCTGG - Intronic
1144905202 17:18635872-18635894 CAACCATCCTGGGCCTCTCCTGG - Exonic
1145828928 17:27899158-27899180 TCAGCAGCCTGGGCCTCACCTGG + Intergenic
1146591770 17:34133569-34133591 CAATGAGCCTGGTACTCACCTGG + Intronic
1146620228 17:34391424-34391446 CAGGGAACCTGGTCCTCACCTGG - Intergenic
1147705004 17:42420372-42420394 CCAGCAGCCGGGTCCCCACCTGG + Intronic
1148196338 17:45716049-45716071 CAAGCCGCATGGTCCTCACTTGG - Intergenic
1149376422 17:56048561-56048583 CAAGCATTCTTGTCCTCCTCAGG + Intergenic
1150001382 17:61443055-61443077 CAAGCATCCTTGACCTCCCTGGG - Intergenic
1150128734 17:62654794-62654816 CAGACATCCAGGTCATCACCTGG - Intronic
1151967033 17:77436814-77436836 CAGGCACCCTGGCCCTCTCCTGG - Intronic
1152636193 17:81431429-81431451 CCAGCACCCAGGTCCACACCTGG + Intronic
1154452166 18:14487080-14487102 GCAGCATCCTGGGCCTCCCCTGG - Intergenic
1156569462 18:38236915-38236937 CGAGCAAACTGGGCCTCACCTGG - Intergenic
1158247760 18:55451356-55451378 CTGGCATCCCTGTCCTCACCTGG + Intronic
1158737926 18:60104938-60104960 CAAGCAGCCTTGTTGTCACCTGG + Intergenic
1160505366 18:79423653-79423675 CCTGCATCCTGAGCCTCACCCGG + Intronic
1163972832 19:20816248-20816270 CAGGCATCTTGGTGCACACCTGG + Intronic
1167034261 19:46984455-46984477 CCAGCGTCCTGTTTCTCACCTGG + Intronic
1167109844 19:47453603-47453625 CAAACATCTTGGTCCTGGCCAGG + Intronic
1167443896 19:49526060-49526082 TCAGCATCCTGGGCCTCCCCTGG - Exonic
927496430 2:23554669-23554691 GAAGCATCCTGTTCCTGAGCAGG + Intronic
932103715 2:68924205-68924227 CAACCATCATGGTCCTCAGTGGG - Intergenic
932715555 2:74098980-74099002 CAAGCCTCCAGGTCCTGGCCAGG + Intronic
932902337 2:75713996-75714018 CAAGTATCCTCGCCTTCACCTGG - Intergenic
933093156 2:78146188-78146210 CAAGGCTCCAGGTCCTCACTGGG - Intergenic
933726107 2:85428263-85428285 TAAGCAACCTGTACCTCACCAGG - Intronic
934576363 2:95404078-95404100 CCAGACTCTTGGTCCTCACCTGG - Intronic
935534194 2:104274018-104274040 CCAGCATCCTGGGAATCACCTGG - Intergenic
936826055 2:116582353-116582375 CCAGCAACATGGTCCTCACCAGG + Intergenic
937907801 2:127060862-127060884 CGAGCCTCCTGCCCCTCACCAGG - Intronic
941359701 2:164537003-164537025 CAAGCATCCTGATCATCTCAAGG + Intronic
944749704 2:202696482-202696504 AAACCATCCTGGTCCTCATGAGG + Intronic
946060006 2:216933612-216933634 CAAGCTTTGTGTTCCTCACCTGG + Intergenic
948496409 2:238352553-238352575 CAGGCCTCCTGGTCCACACCTGG - Intronic
948619994 2:239228230-239228252 CCAGCAGGCTGCTCCTCACCTGG - Intronic
948815351 2:240507541-240507563 CCAGCCTCCTGCCCCTCACCAGG + Exonic
948922688 2:241073138-241073160 CAGGGAGCCTGGTCCCCACCAGG + Intronic
1170627961 20:18043929-18043951 CAAGAAGACTGGTCCTCTCCTGG + Intronic
1172598640 20:36168228-36168250 CAAGCATCCCTGGCCTCACTGGG + Intronic
1173521322 20:43702481-43702503 CAAGCATCAGGGTCCTGTCCAGG - Exonic
1173956250 20:47035227-47035249 CAAGGATCCTGCTGCTCAGCTGG + Intronic
1176255842 20:64152537-64152559 CAAGCACCCTGTTCCTCAGGTGG + Intronic
1176443859 21:6801220-6801242 GCAGCATCCTGGGCCTCCCCTGG + Intergenic
1181004014 22:20001124-20001146 CTAGCATGCTGATCTTCACCAGG - Intronic
1181074948 22:20369271-20369293 CCAGCAAGCAGGTCCTCACCAGG + Intronic
1181393117 22:22598430-22598452 CAAGCAGCATGAGCCTCACCTGG - Intergenic
1182000169 22:26913613-26913635 CCAGCAACATGGGCCTCACCTGG - Intergenic
1182449059 22:30407537-30407559 CCCGCATCTTGGTCCTCAGCAGG - Exonic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183901524 22:41009597-41009619 GCAGCATCCTGCACCTCACCAGG + Intergenic
950541948 3:13618147-13618169 CACTCATCCTGGTCATCGCCCGG - Exonic
953492264 3:43362271-43362293 CAAGCATCCTGGGCCTGAACAGG - Intronic
955026090 3:55169097-55169119 CCAGCATCCTGGTCTTCTCCAGG + Intergenic
955324260 3:57997649-57997671 CTAGCAGCCTGGACGTCACCTGG - Intergenic
955337481 3:58098823-58098845 CATGCAGCCTGGCCCTCACGTGG + Exonic
959265622 3:104133815-104133837 CAAGCATCATGGCCACCACCAGG + Intergenic
961487773 3:127229035-127229057 CAAGCAACCTTGGCATCACCAGG - Intergenic
961539222 3:127589174-127589196 CCAGCATCCTGTCCCTCAACTGG - Intronic
962809632 3:138949530-138949552 CAGGCATCCTCTTCTTCACCAGG - Exonic
962874280 3:139523916-139523938 CAGGCATCGTGGTGCTCAGCAGG - Intronic
965624016 3:170668986-170669008 CAAGCTTGCTGGTCCTCATCAGG - Intronic
967266687 3:187698008-187698030 CAAGGTACCTGGTCCTCTCCTGG - Intergenic
977815793 4:101412298-101412320 AAAGCATTTTGCTCCTCACCAGG - Intronic
978807550 4:112816366-112816388 CAAGCATCCTGGTCAACTCAGGG + Intergenic
979709171 4:123757444-123757466 CAAGCATCCTCCACCACACCTGG + Intergenic
981672464 4:147302428-147302450 CAAGCAGCCTGGACATCACCTGG - Intergenic
982754260 4:159199845-159199867 CAAGAAACCTGTTTCTCACCTGG - Intronic
983550279 4:169010381-169010403 CAAGCATCGAGGCCCTCTCCAGG - Intergenic
984874316 4:184353890-184353912 CGTCCATCCTGGTCCTCCCCAGG - Intergenic
986674173 5:10168879-10168901 AGATGATCCTGGTCCTCACCAGG + Intergenic
987335682 5:16895962-16895984 CCAGCATGCTGCTCCTCAACCGG + Intronic
987393076 5:17394877-17394899 AAAGCATCCTGCTCCAGACCAGG - Intergenic
994158818 5:96532571-96532593 CAGGCATCGTGGCCCACACCTGG + Intronic
995022531 5:107382512-107382534 CAGGCATCGTGGTTCACACCTGG - Intronic
995624555 5:114061761-114061783 AAACCATCATGGTCCTCACCTGG - Intergenic
995811767 5:116114867-116114889 AAAGCAGTCTGGTCCTGACCTGG - Intronic
996502875 5:124236118-124236140 CAAGTATCTTGGCCCTAACCTGG + Intergenic
996811304 5:127518241-127518263 CGAGCCTCCTGGGCCTCTCCAGG - Intronic
997826367 5:137110329-137110351 CCAGCAGCTTGGTCATCACCTGG + Intronic
998179988 5:139930142-139930164 CAATAAACCTGGTCCTCACTTGG - Intronic
999113428 5:149141577-149141599 CATGAATCCTGGTCCTCGTCTGG - Intronic
999816773 5:155184804-155184826 CAAGCATCCTGCTACTAACCTGG - Intergenic
1002445745 5:179288797-179288819 CACAGATCCTGGTCCTCACAAGG + Intronic
1002661380 5:180792965-180792987 TCAGCATCCTGGCCCCCACCGGG + Exonic
1008762103 6:54863431-54863453 TAAGCCTCATGGTGCTCACCAGG - Intronic
1011752084 6:90463591-90463613 CACACATCCTGTTCCTCACTGGG - Intergenic
1013113439 6:107082309-107082331 CACGTATCTGGGTCCTCACCTGG - Intronic
1015293945 6:131569252-131569274 TAAGAATCCTGGGCCTCATCTGG + Intergenic
1015523375 6:134153017-134153039 CAATCAACCTGGCCCCCACCAGG + Intergenic
1019105411 6:169663610-169663632 CCAGCAACCTTGTCCTCACCTGG - Intronic
1019105421 6:169663667-169663689 CCAGCACCCTCGTACTCACCTGG - Intronic
1019117409 6:169776408-169776430 CAGGCATCATGATCCTCACCTGG - Intronic
1022963313 7:35450783-35450805 CTGGCATCCAGGTCCTCACATGG + Intergenic
1023165432 7:37338732-37338754 CAAGCATCCTCATCCTCAAGCGG + Intronic
1023207862 7:37770396-37770418 CTTGCTTCCTTGTCCTCACCAGG + Intronic
1023779686 7:43644116-43644138 CAGGCATGCTGCTCCTCAGCCGG + Intronic
1024574985 7:50755951-50755973 CCGGCAGCCAGGTCCTCACCTGG - Intronic
1025142085 7:56474966-56474988 CAAGGATCCTGGAGCTCATCGGG + Intergenic
1026117513 7:67508482-67508504 CAGGCCTCCTGGTCCTAACATGG - Intergenic
1029261068 7:99303235-99303257 CAGGCAGCCTGGTCCTCAGCAGG - Intergenic
1031527911 7:122843875-122843897 TAAGCATGCTGGTCCTCACCTGG - Intronic
1031560640 7:123233882-123233904 CAGGCTTCCTGGTCCACACCAGG - Intergenic
1032656480 7:133936082-133936104 CAAGCAGCCTGGGCATCACCTGG + Intronic
1041672329 8:60504246-60504268 CAAGAGTCCAGGACCTCACCAGG - Intergenic
1043357015 8:79425459-79425481 TGAGCCTCCTGCTCCTCACCAGG - Intergenic
1045189557 8:99869331-99869353 GAGGCATCCTGCTCCTCAGCAGG + Intronic
1047401991 8:124555882-124555904 CAAGCCTCCATCTCCTCACCAGG + Exonic
1051844232 9:21433842-21433864 CAAGAATCCTGGTCTTTTCCAGG - Intronic
1055639452 9:78308195-78308217 CCGTCAGCCTGGTCCTCACCTGG - Intronic
1061196910 9:129111568-129111590 CAAGCATCCGGGTCGGCTCCTGG + Exonic
1061351006 9:130064861-130064883 TAAGAATCCTGGTAATCACCAGG + Intronic
1061986178 9:134131571-134131593 CCAGCATCCTGACCCTCACCAGG - Intergenic
1203525341 Un_GL000213v1:83307-83329 GCAGCATCCTGGGCCTCCCCTGG - Intergenic
1185722346 X:2392143-2392165 AAAGCATCCTGGTCCTTCCTGGG + Intronic
1186487770 X:9946629-9946651 CTTTCATCCTGGTCCTCAACAGG + Intronic
1186546724 X:10457709-10457731 AAAGCCTCCTGGGCCACACCAGG - Intronic
1190842425 X:54157735-54157757 AAAGCAGCCAGGTCCTCATCTGG + Exonic
1193786331 X:85763788-85763810 CAAGCATCATTGGCATCACCTGG + Intergenic
1193829131 X:86266235-86266257 CAAGCAGCATGGACATCACCTGG - Intronic
1195689920 X:107616068-107616090 CAAGCAACCTGGCCCACTCCTGG - Intergenic
1198651345 X:138866691-138866713 CCAGCATCCTGGGTTTCACCTGG + Intronic
1200932129 Y:8706565-8706587 CCTTGATCCTGGTCCTCACCAGG + Intergenic