ID: 1142140003

View in Genome Browser
Species Human (GRCh38)
Location 16:88468673-88468695
Sequence GCTCTGGGGGGCGGGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 508}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142140003_1142140014 -5 Left 1142140003 16:88468673-88468695 CCCAGGGCCCCGCCCCCCAGAGC 0: 1
1: 0
2: 1
3: 54
4: 508
Right 1142140014 16:88468691-88468713 AGAGCCCCACCCCCATGGCCAGG 0: 1
1: 0
2: 5
3: 26
4: 358
1142140003_1142140025 22 Left 1142140003 16:88468673-88468695 CCCAGGGCCCCGCCCCCCAGAGC 0: 1
1: 0
2: 1
3: 54
4: 508
Right 1142140025 16:88468718-88468740 CACTGTCCTAACCAGCCTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 128
1142140003_1142140015 -4 Left 1142140003 16:88468673-88468695 CCCAGGGCCCCGCCCCCCAGAGC 0: 1
1: 0
2: 1
3: 54
4: 508
Right 1142140015 16:88468692-88468714 GAGCCCCACCCCCATGGCCAGGG 0: 1
1: 0
2: 2
3: 45
4: 410
1142140003_1142140010 -10 Left 1142140003 16:88468673-88468695 CCCAGGGCCCCGCCCCCCAGAGC 0: 1
1: 0
2: 1
3: 54
4: 508
Right 1142140010 16:88468686-88468708 CCCCCAGAGCCCCACCCCCATGG 0: 1
1: 1
2: 8
3: 87
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142140003 Original CRISPR GCTCTGGGGGGCGGGGCCCT GGG (reversed) Intronic