ID: 1142141151

View in Genome Browser
Species Human (GRCh38)
Location 16:88473444-88473466
Sequence GCCTGTCCTCGAGGGCCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142141136_1142141151 21 Left 1142141136 16:88473400-88473422 CCCTCTCACCATGGCCTTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1142141151 16:88473444-88473466 GCCTGTCCTCGAGGGCCGCAGGG No data
1142141134_1142141151 22 Left 1142141134 16:88473399-88473421 CCCCTCTCACCATGGCCTTGAGG 0: 1
1: 0
2: 2
3: 27
4: 227
Right 1142141151 16:88473444-88473466 GCCTGTCCTCGAGGGCCGCAGGG No data
1142141138_1142141151 20 Left 1142141138 16:88473401-88473423 CCTCTCACCATGGCCTTGAGGGC 0: 1
1: 0
2: 0
3: 25
4: 226
Right 1142141151 16:88473444-88473466 GCCTGTCCTCGAGGGCCGCAGGG No data
1142141144_1142141151 7 Left 1142141144 16:88473414-88473436 CCTTGAGGGCGGGGTGAGGTGAA 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1142141151 16:88473444-88473466 GCCTGTCCTCGAGGGCCGCAGGG No data
1142141142_1142141151 13 Left 1142141142 16:88473408-88473430 CCATGGCCTTGAGGGCGGGGTGA 0: 1
1: 1
2: 1
3: 15
4: 175
Right 1142141151 16:88473444-88473466 GCCTGTCCTCGAGGGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142141151 Original CRISPR GCCTGTCCTCGAGGGCCGCA GGG Intronic