ID: 1142142085

View in Genome Browser
Species Human (GRCh38)
Location 16:88476991-88477013
Sequence ACGTGCGCACGCCCGTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 25}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142142085 Original CRISPR ACGTGCGCACGCCCGTGCGC CGG Intronic
922917548 1:229271060-229271082 CCGTGCGCACGCGCGAACGCGGG + Intronic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1076714699 10:132357844-132357866 AGGTGCGCGCTCCCGTGGGCAGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1088914743 11:114219036-114219058 GCGTGTGCACGCCCATGTGCTGG + Intronic
1091240826 11:134051051-134051073 ACGCACGCACGCACGTACGCAGG - Intergenic
1096773327 12:53950043-53950065 CCGTCCCCAGGCCCGTGCGCCGG - Intergenic
1121352443 14:93184572-93184594 TCGTGCCCGCGTCCGTGCGCCGG + Exonic
1122171583 14:99880415-99880437 ACGTGCGCAGCCCCATGCTCAGG + Intronic
1126746297 15:51829619-51829641 GCGTGCGCACTCCCGTGCCGCGG - Exonic
1141521893 16:84586001-84586023 ACGTGCACACGCCTTTGGGCAGG - Intronic
1142142085 16:88476991-88477013 ACGTGCGCACGCCCGTGCGCCGG + Intronic
1149995473 17:61404103-61404125 ACTTGCGCAAGCCCGCGGGCGGG + Intronic
1152815215 17:82403916-82403938 AGGTGAGCGCGCCCGTGGGCAGG - Exonic
1154274677 18:12948456-12948478 ACGTGCGCGCTCCCGCCCGCAGG + Intronic
934783318 2:96986635-96986657 ACGTGCGCATCCACGTGCGCGGG + Intronic
945699430 2:213151769-213151791 ACGTCCGCTCGCCCGCGCCCGGG - Intronic
1175987286 20:62770433-62770455 CCGTGCGCATGCCGGTGAGCGGG - Intergenic
1180220501 21:46355279-46355301 ATGTGAGCACGCCAGTGGGCTGG + Intronic
1181934572 22:26429465-26429487 CCGTCCGCGCGCCCGGGCGCAGG + Exonic
961664352 3:128486823-128486845 ACGCGCGCCCGCGCGTGAGCGGG + Exonic
981597685 4:146445917-146445939 ACGTGCGCACGCGCGTGCACGGG + Intronic
1000230371 5:159310331-159310353 AAGTGCGCACCCCTGTGCTCTGG + Intergenic
1019103133 6:169648289-169648311 CCGTGCACACGCCCGAGCCCTGG + Intronic
1035717232 8:1763748-1763770 GCGTGCGAACGCGCGTGCGCGGG + Exonic
1040862017 8:52008667-52008689 AAGTGCGTGCGCCCGTGCCCAGG - Intergenic
1061453464 9:130681438-130681460 AGGGGCGCTCGCCCGTGTGCAGG - Exonic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic