ID: 1142142085

View in Genome Browser
Species Human (GRCh38)
Location 16:88476991-88477013
Sequence ACGTGCGCACGCCCGTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 25}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142142085 Original CRISPR ACGTGCGCACGCCCGTGCGC CGG Intronic