ID: 1142143734

View in Genome Browser
Species Human (GRCh38)
Location 16:88483940-88483962
Sequence TCCTTCTCTCGCATCTTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142143730_1142143734 1 Left 1142143730 16:88483916-88483938 CCTGAAACTCAGTCACAGCATTT 0: 1
1: 0
2: 2
3: 13
4: 229
Right 1142143734 16:88483940-88483962 TCCTTCTCTCGCATCTTCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1142143729_1142143734 14 Left 1142143729 16:88483903-88483925 CCTTGGACATCAGCCTGAAACTC 0: 1
1: 1
2: 1
3: 11
4: 214
Right 1142143734 16:88483940-88483962 TCCTTCTCTCGCATCTTCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142143734 Original CRISPR TCCTTCTCTCGCATCTTCGG GGG Intronic
900764140 1:4492748-4492770 TCCTTCTCTAGCACCTTTAGAGG - Intergenic
901134817 1:6986359-6986381 TCCCTCTGTCACATCTTGGGTGG - Intronic
902986270 1:20156247-20156269 CCCTTCTCTCGCCCCTTTGGGGG - Intergenic
910757177 1:90706421-90706443 CCCTTCTCTCACATCTCGGGGGG - Intergenic
918413936 1:184288010-184288032 TCCTTTTCTCCCATGTTGGGGGG - Intergenic
918718878 1:187826543-187826565 TCCCTCTCTCGCACTTTGGGAGG + Intergenic
919364307 1:196637825-196637847 TTCTTCTCTGGCATCTCTGGAGG + Intergenic
1063193256 10:3717698-3717720 TCCTTCTCTCGGCTCCTTGGGGG - Intergenic
1070570225 10:77635759-77635781 TCATTCTCTGGCTTCTCCGGAGG - Intronic
1084411617 11:69009268-69009290 TCCTTCGCTCTCAACTTCGAAGG - Intronic
1086345639 11:85893090-85893112 CCCTTCTCTGGCAGCTTGGGTGG - Intronic
1091397507 12:163080-163102 TCCTTCTCTCTCCTCGTCTGAGG - Intronic
1091566876 12:1655360-1655382 TCCTTCCCTTGCCTCCTCGGTGG - Intergenic
1095976622 12:47944342-47944364 CCCTACTCTCGCAGCTTCTGGGG + Intergenic
1103778518 12:123384005-123384027 CCCTTCTCCCGCCTCTTCGGCGG - Exonic
1108748299 13:53418772-53418794 ACCTTCTCTCTCCTCTTCTGTGG - Intergenic
1117413378 14:55470885-55470907 TCTCTCTCTCTCATCTTGGGGGG - Intergenic
1126675371 15:51155919-51155941 TCCTCCACTGGCATCTCCGGTGG + Intergenic
1127875935 15:63111389-63111411 TCCCTGTCTCACATCTTCAGTGG - Intergenic
1141493592 16:84391337-84391359 GCCATCTCTCGCATCTTCTGTGG + Intronic
1141709282 16:85688696-85688718 CCCTGCTCCCGCATCTGCGGAGG - Intronic
1142143734 16:88483940-88483962 TCCTTCTCTCGCATCTTCGGGGG + Intronic
1144623446 17:16832576-16832598 TCCTTCTCTCGCTTCTCCTTTGG - Intergenic
1144882986 17:18440140-18440162 TCCTTCTCTCGCTTCTCCTTTGG + Intergenic
1145149246 17:20504246-20504268 TCCTTCTCTCGCTTCTCCTTTGG - Intergenic
1146942335 17:36851927-36851949 TCCTTCTCAGTCATCTTGGGAGG - Intergenic
1147486466 17:40819423-40819445 TCATTCTCTGGCATCTTCTTGGG + Intronic
1148392106 17:47280150-47280172 TCTTTCTCTCTCATCTTCACAGG - Intronic
1148997707 17:51725628-51725650 TCCTTCTCCAGCATCCTGGGGGG + Intronic
1150881141 17:69029824-69029846 TCCTCCTCTCTCATCTTCTTTGG - Intronic
1151385283 17:73751568-73751590 TCCTTCTCTCACAGTTTTGGAGG + Intergenic
1152331428 17:79675417-79675439 TCCTTATCTCGGGTCTTCTGGGG + Intergenic
1156058882 18:33048169-33048191 TCTCTCTCTAGCATCTTCAGAGG + Intronic
1161934793 19:7364977-7364999 TCCTTCTCCCACAGCCTCGGAGG + Intronic
1164480658 19:28608914-28608936 CCCTTCTCTCGCCCCTTTGGGGG - Intergenic
1164859425 19:31551169-31551191 TCCTTCTCTCCCCTCTTGGTGGG + Intergenic
1166367317 19:42284241-42284263 TCCCTCCCTCGCAGCTCCGGCGG - Intronic
928381856 2:30824827-30824849 TCCTTCCCTGGCACCTTTGGAGG + Intergenic
929352158 2:40969642-40969664 TACTTCTCTCTCATCTTCAAAGG + Intergenic
932261002 2:70327369-70327391 TCCTTCCCTACCATCTTCAGAGG + Intergenic
932584417 2:73017237-73017259 TCCTTCTCACCCATCCTCTGAGG - Intronic
937241797 2:120466600-120466622 TCCCTCTCTCGGCTCTTCTGAGG + Intergenic
941019348 2:160391350-160391372 TCCTTCCCTGGCACCTTCAGAGG + Intronic
941344610 2:164352169-164352191 TCCTTCCCTAGCATCTTCAGAGG - Intergenic
943477088 2:188370136-188370158 GCCTACTCTCGTATCTTCAGAGG + Intronic
943650060 2:190448025-190448047 TCTTTCTCTTCCATCTTCAGTGG + Intronic
943795564 2:191988760-191988782 TCTTTCTTTCACATCTTCTGAGG - Intronic
945742927 2:213685433-213685455 TCCTTCCCTAGCACCTTCAGTGG + Intronic
948075695 2:235163735-235163757 CCTTTCTCTCCCATCTTCCGAGG + Intergenic
948582937 2:239000228-239000250 TCTGTCTCTCGCAGCTGCGGAGG + Intergenic
1169124032 20:3114334-3114356 TTCTTTTCTCCTATCTTCGGTGG - Intronic
1174203852 20:48825868-48825890 TTCTTCTCTCACAGTTTCGGGGG - Intronic
1175170008 20:57073783-57073805 TTGTTCTCTCGCATTTTTGGAGG + Intergenic
1178494842 21:33077927-33077949 TCCATCTCTCCCATCTCCTGTGG - Intergenic
1181899990 22:26145748-26145770 TCCTTTTCTCGCAGTTCCGGAGG - Intergenic
1183785826 22:40028590-40028612 TCCTGCTCTCGGACCTCCGGAGG - Intronic
1184815991 22:46870648-46870670 TCCGTCTCTCCCAGTTTCGGAGG + Intronic
949852781 3:8435748-8435770 CCCTTCTCTAGCACCTTCAGAGG + Intergenic
950415576 3:12867303-12867325 TCCTGCTTTCTCATCTTCTGAGG + Intronic
954724230 3:52593806-52593828 TCCTTCTTTTGCATTTTCTGAGG + Intronic
957022113 3:75138598-75138620 CCCTTCTCTTGCTCCTTCGGGGG - Intergenic
959122458 3:102248737-102248759 TGCTTCTCTAGCATCTTCCCTGG + Intronic
960620244 3:119630267-119630289 TCCTTCTCTGGCCTCTTCACAGG - Intergenic
969313793 4:6369727-6369749 TCCTTCTCTGGCTTCCTTGGCGG + Intronic
969788685 4:9477150-9477172 TCCTTCCCTTGCCTCTTTGGGGG - Intergenic
970180324 4:13384749-13384771 TCATTCTTTCTCATCTTTGGGGG - Intronic
977289028 4:95143382-95143404 TCCTTCCCTGGCACCTTCAGAGG + Intronic
982873501 4:160614155-160614177 TCCTTCTCTGGCACCTACAGAGG + Intergenic
984978556 4:185254723-185254745 TCATTCTCTCTCATCTCCAGTGG + Intronic
986293683 5:6420195-6420217 GCCTTTTCTGGCATCTTCAGAGG - Intergenic
986501076 5:8400760-8400782 TGCTTCTCTCGCCTCTCTGGTGG + Intergenic
991043070 5:62195341-62195363 TCCTTCTCTCCCAACTTCACTGG + Intergenic
992751651 5:79868093-79868115 TCCTTCCCTAGCACCTTCAGAGG - Intergenic
1003223210 6:4180294-4180316 TCCTTCTGTAGCACCTTCAGAGG + Intergenic
1003495903 6:6663003-6663025 CCCTTCCCTCGCAGCTTCAGAGG - Intergenic
1004061989 6:12206572-12206594 TCCTTCCCTGGCATCTTTAGAGG + Intergenic
1004489462 6:16100449-16100471 TCCTTCTCACCCACCTTCTGGGG + Intergenic
1007070325 6:39032458-39032480 TCCTTCTCTCTCAGCTTCATTGG - Intergenic
1007257331 6:40538223-40538245 TCCTTCTCTCCCCTCTTCCCAGG - Intronic
1007725715 6:43914552-43914574 TCCTTCTCACTCATCATGGGGGG + Intergenic
1015739044 6:136433759-136433781 TCCTTCTCTAGCACCTTCTCTGG + Intronic
1016789485 6:148052961-148052983 TCCTTCTCTCACAGCCTCTGAGG + Intergenic
1018937514 6:168283422-168283444 TCTCTCTCTCTCATCTTCTGGGG - Intergenic
1019153059 6:170021873-170021895 TGCTTCCCTCACATCTGCGGGGG + Intergenic
1023101235 7:36720794-36720816 CCCTGCTCTCGCATATTCAGTGG + Intronic
1027555133 7:79654522-79654544 TCCTTCTTTCGCTTCTTTGTGGG + Intergenic
1029506237 7:100965610-100965632 TCCTCCTCGCGCATATTCAGAGG + Intronic
1029712354 7:102306781-102306803 TCCTTCTCTGGCATTTCCAGGGG - Exonic
1030688735 7:112511560-112511582 TCCTTCTCTAGCACCTTCAGAGG - Intergenic
1030778296 7:113564409-113564431 TCCTCCTCTCCCAGCTTCTGTGG + Intergenic
1033157152 7:138966834-138966856 TCCTTCTCTAGCACCTTTGGAGG + Intronic
1033872107 7:145766971-145766993 TCCCTCTCTCTGATCTTCAGGGG + Intergenic
1036425417 8:8641466-8641488 TCCTTCCCTCACATCTTCCTGGG + Intergenic
1036489826 8:9214623-9214645 TCCTTCTCTACCACCTTCAGAGG + Intergenic
1038734531 8:30156742-30156764 CCCTTCTCCCGCATAATCGGCGG + Intronic
1039758218 8:40545688-40545710 CCCTTCTCTTGCACCTTCAGAGG + Intronic
1043161789 8:76855068-76855090 GCTTTCTCCCCCATCTTCGGTGG - Exonic
1045488732 8:102654482-102654504 TCCTCCTCCCGCATCTGAGGCGG - Intronic
1045568905 8:103349767-103349789 TACTTCTCTGGCATCTTCAATGG + Intergenic
1048921726 8:139237529-139237551 TCCTTCTCTAGAACCTTCAGAGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1056197326 9:84240928-84240950 TCCTTCTCTCTGATCATCAGGGG - Intergenic
1062419850 9:136475214-136475236 TCCTCCTCTCCCATTTTGGGAGG + Exonic
1189270560 X:39748643-39748665 TCCTTCCCTCGAATCTTCTGAGG + Intergenic
1190148747 X:47922818-47922840 TCCTTCCCTAGCACCTTCAGAGG - Intronic
1196554205 X:117067730-117067752 TTCTTCTCTCGCATTTCTGGAGG - Intergenic
1199843197 X:151671605-151671627 TCCTGATCTCCAATCTTCGGAGG + Exonic
1200163015 X:154018934-154018956 TCCTTGTCTCGAATCTTCCCTGG + Intronic