ID: 1142144333

View in Genome Browser
Species Human (GRCh38)
Location 16:88486559-88486581
Sequence CTGGGTACACAGTGGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 4, 2: 12, 3: 48, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142144333 Original CRISPR CTGGGTACACAGTGGGTGCT AGG Intronic
900733331 1:4277702-4277724 CTGGGTACAGAGAAAGTGCTTGG + Intergenic
900792905 1:4691474-4691496 CTGGGTACACAGTGGGGCTCGGG + Intronic
900815891 1:4845498-4845520 CTGGGTACCATGTGGGTACTTGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901218259 1:7566869-7566891 GTGGGCACAGAGGGGGTGCTCGG - Intronic
902379346 1:16045346-16045368 GTGGTGACACAGTGGGTGCCAGG - Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
904421571 1:30397826-30397848 CCTGGTACACAGTAGGTGCTTGG - Intergenic
904452046 1:30619615-30619637 CTGGGAACACAGTGAGAGTTAGG - Intergenic
906144599 1:43552454-43552476 CCTGGTGCAGAGTGGGTGCTTGG + Intronic
907444977 1:54501669-54501691 ATGGGTACACAGTGGGGTCCCGG - Intergenic
907666328 1:56436525-56436547 CTGGGCACAGAGTAGGTGCCAGG - Intergenic
908796412 1:67834162-67834184 GTTGGTACACAGCGGGTGCTTGG - Intergenic
909840350 1:80313286-80313308 ATGGGTGGACAGTGGGAGCTTGG - Intergenic
910836954 1:91523619-91523641 CTGGGCACACAAGGGGTGCAGGG + Intronic
911887223 1:103318964-103318986 CCAGGTACACAGTGGATTCTAGG - Intergenic
914392814 1:147237181-147237203 CTGGGAATGGAGTGGGTGCTGGG + Intronic
914424786 1:147565836-147565858 CTTGGGACATAGTAGGTGCTTGG + Intronic
915988376 1:160489240-160489262 CTGGGGACACAGTGTGCTCTGGG - Intronic
917401464 1:174653588-174653610 CTGGTTAGACAGTGGGTACGGGG - Intronic
919981670 1:202645819-202645841 ATGGGAACACAGTGGGTCCCTGG + Intronic
920022583 1:202967061-202967083 CTGGGCCCACCGTGGATGCTGGG - Intronic
920045466 1:203129500-203129522 ATGGGGTCACAGTGAGTGCTGGG + Intronic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
921133008 1:212235896-212235918 CTGGGTAATCAGTGAGTGCTTGG + Intergenic
921950581 1:220926028-220926050 GTGATTACACAGTGGGTTCTTGG - Intergenic
923765047 1:236885444-236885466 CTGGGTACCCAGTAGGTGTTAGG + Intronic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
924708784 1:246518210-246518232 ATGGGGACTCAGTGGGTGTTCGG - Intergenic
1063333365 10:5184912-5184934 TTGGGTAGACAGTGGATGCTTGG - Intergenic
1063669681 10:8089933-8089955 TTGGTTTCACAGTGTGTGCTAGG - Intergenic
1066061853 10:31731041-31731063 CTTGGTAACCAGTAGGTGCTAGG + Intergenic
1066305218 10:34133590-34133612 CTGGTTACTCAGTGTGTGCCAGG + Intronic
1066312092 10:34207007-34207029 CTGGGCACACAGTGACAGCTAGG - Intronic
1068607021 10:59016851-59016873 CTGGGAACACAGTGGCTGCTTGG - Intergenic
1069747327 10:70724069-70724091 CCTGGCACACAGTAGGTGCTTGG + Intronic
1070382462 10:75893231-75893253 CTGAGGGCTCAGTGGGTGCTAGG + Intronic
1070554756 10:77518921-77518943 ATGCGTGGACAGTGGGTGCTGGG - Intronic
1070932242 10:80269547-80269569 CTTGGCACAGAGTAGGTGCTTGG - Intergenic
1071341416 10:84652194-84652216 CTGGTTAGACAGTGGGTACAAGG - Intergenic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073575868 10:104622612-104622634 ATGGGTAGAAAGTGGGGGCTGGG - Intergenic
1074104042 10:110375743-110375765 CTGGGCACTCAGTGTGTTCTGGG + Intergenic
1075336114 10:121609782-121609804 CTTAGCACAGAGTGGGTGCTTGG + Intergenic
1075439658 10:122469592-122469614 CTGGGTGCTCTGTGGGAGCTGGG + Intronic
1075630204 10:123995943-123995965 CTGGGCACACAGTGGGTCGCAGG + Intergenic
1075733521 10:124650472-124650494 CTGGCCACACTGTGCGTGCTTGG - Intronic
1076133509 10:128029357-128029379 CCTGGCTCACAGTGGGTGCTGGG - Intronic
1076333875 10:129692055-129692077 CTGAGCACCCACTGGGTGCTGGG - Intronic
1076501913 10:130943855-130943877 CTGGGTACTCAGATGGTCCTGGG + Intergenic
1076683140 10:132185631-132185653 CTCGGGACACACTGGGCGCTGGG - Intergenic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1076794129 10:132790581-132790603 GTGGGGCCACAGTGGGTGCCCGG + Intergenic
1077340983 11:2026234-2026256 GTGGGTACACAGTGGGCACTTGG - Intergenic
1078022304 11:7665995-7666017 CTCTGTGCACAGTGGTTGCTGGG + Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079415482 11:20231683-20231705 CTGGGTACAGAGTGTCTGTTTGG + Intergenic
1079593715 11:22214334-22214356 CTGGGTACACAGTTGATTCTAGG - Intronic
1081547775 11:44083820-44083842 CCAGGTCCACAGTGGCTGCTGGG - Exonic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1082011677 11:47453895-47453917 CTGCGGACACAGTGGGATCTCGG + Intergenic
1083576704 11:63797120-63797142 CTGGGTACACAGCAGGTGATGGG - Intergenic
1083921858 11:65785659-65785681 GCTGGTACACAGTGGGTGCTCGG - Intergenic
1084088804 11:66866891-66866913 AGGGTTGCACAGTGGGTGCTGGG + Intronic
1084296195 11:68214352-68214374 CGGGGCACATAGTGGGTGCTGGG - Intergenic
1084501424 11:69537875-69537897 CCGGGCACCCACTGGGTGCTGGG - Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1087006870 11:93479817-93479839 CTTGGCACACGGTGGGTGCTTGG - Intronic
1087212826 11:95460847-95460869 GTGAGCACACAGTGGGTTCTGGG - Intergenic
1087321206 11:96660995-96661017 CTGGTTACACAGTGCCTGCAAGG - Intergenic
1089707449 11:120289962-120289984 TTTGGTATACAGTAGGTGCTTGG + Intronic
1089809645 11:121121214-121121236 CCTGGCACACAGTAGGTGCTCGG + Intronic
1090986522 11:131771630-131771652 GTGTGTACACAGCTGGTGCTTGG - Intronic
1202823968 11_KI270721v1_random:81423-81445 GTGGGTACACAGTGGGCACTTGG - Intergenic
1093599431 12:21003113-21003135 CTTAGTACACACTGGGTACTGGG + Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096240520 12:49957466-49957488 CCTGGTGCACAGTGGGTGCTTGG - Exonic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1100395266 12:94180557-94180579 CTGGGTACATAATGGGTGTTGGG + Intronic
1101732134 12:107435566-107435588 CCTGGCACACAGTAGGTGCTAGG + Intronic
1101760172 12:107651866-107651888 CAGGGCAGAGAGTGGGTGCTGGG + Intronic
1101841992 12:108334366-108334388 CTGGCCACATAGTGGGTGCCTGG - Intronic
1101858117 12:108461072-108461094 TTGGCTGCAGAGTGGGTGCTGGG - Intergenic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1104906876 12:132218247-132218269 CTGGGAACACAGGGCTTGCTTGG - Intronic
1104947967 12:132425476-132425498 CTCGGTGCACAGTGGGTGGCAGG + Intergenic
1107596921 13:41972937-41972959 CTGGGTACAGAGAGGATGTTTGG + Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1112331928 13:98483309-98483331 TTGGGTTCACAGTGGGTTCACGG + Intronic
1113965067 13:114147955-114147977 CTGGGTTCTCCGTGGGGGCTGGG - Intergenic
1115242332 14:31261913-31261935 CTGGGCACCCACTGTGTGCTGGG - Intergenic
1115504841 14:34083855-34083877 CTGGGTACACAGTGGACCCTTGG - Intronic
1115531359 14:34331045-34331067 GTGGGGTCACAGTGGGTGGTGGG - Intronic
1117275909 14:54192973-54192995 ATGGGGAAGCAGTGGGTGCTTGG - Intergenic
1117650526 14:57900192-57900214 CTGGGTCCCCAGTGGGGCCTTGG - Intronic
1117724992 14:58664229-58664251 CAGGGTACAGAATGGATGCTGGG + Intergenic
1118314665 14:64718518-64718540 CTTTGTGCACAGTAGGTGCTTGG + Intronic
1119888145 14:78161826-78161848 CTGGATATACAGTAGGTGTTAGG - Intergenic
1120211641 14:81639571-81639593 TTGGGTACACAGTGAGCTCTGGG - Intergenic
1120217547 14:81696045-81696067 CTAGGTTCACAGTTGGTGGTTGG + Intergenic
1121418531 14:93796084-93796106 CTGAGTATACAGTTGGTGGTAGG - Intergenic
1121991623 14:98563345-98563367 TTGGGGACACTGTGGGAGCTGGG - Intergenic
1122572623 14:102717403-102717425 CTGAGCACACAGAGTGTGCTTGG - Intronic
1122870703 14:104636991-104637013 CTGCCCACACAGTGGGCGCTGGG + Intergenic
1123500253 15:20875550-20875572 CTGGGTATAGAGTGGTTGCCAGG - Intergenic
1123557499 15:21449244-21449266 CTGGGTATAGAGTGGTTGCCAGG - Intergenic
1123593726 15:21886506-21886528 CTGGGTATAGAGTGGTTGCCAGG - Intergenic
1125888842 15:43250695-43250717 CTTGGAACACAGTGAGTGCCTGG + Intronic
1126486546 15:49187752-49187774 TTGGGTAAACAGTGGGAGCCAGG - Intronic
1127293180 15:57588429-57588451 CTCAGTACACAGTAGGTGCTTGG + Intergenic
1127635003 15:60860776-60860798 CTGGGCACCCACTGTGTGCTAGG + Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1128701509 15:69807896-69807918 CTGGGCACTCAGTGGCTGCTGGG - Intergenic
1128702443 15:69814114-69814136 CCGGGCACACAGCGGGGGCTGGG - Intergenic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1130059069 15:80556658-80556680 TTTGGCACACAGTAGGTGCTCGG - Intronic
1130702146 15:86195115-86195137 CTGGGTATTTTGTGGGTGCTGGG + Intronic
1131258692 15:90877407-90877429 CTGGGTACTCAGGGGATGATGGG + Intronic
1131793434 15:95989202-95989224 CTGGGTACAAAGTGGACACTCGG + Intergenic
1132004818 15:98217616-98217638 CAGGGCACACAGTCGGTCCTGGG + Intergenic
1132242278 15:100266928-100266950 CTGGGTACTTAGTGTGTGCTAGG - Intronic
1202965849 15_KI270727v1_random:176417-176439 CTGGGTATAGAGTGGTTGCCAGG - Intergenic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1132671265 16:1103070-1103092 CTGGGTGCGCGCTGGGTGCTTGG + Intergenic
1133815704 16:9195799-9195821 CTGGTTCCACCATGGGTGCTGGG + Intergenic
1134122849 16:11596871-11596893 CTGAGTACCCACTGGGTGCCAGG + Intronic
1135193288 16:20372955-20372977 CTGGGGCCACTGTGTGTGCTTGG - Intronic
1135906835 16:26519770-26519792 TTTAGTACACAGTAGGTGCTCGG - Intergenic
1137724547 16:50648147-50648169 CTGGGTTCACAGTGGGGCCCAGG - Intergenic
1138161350 16:54757883-54757905 CTGGGTACAGTGTGAGTGTTTGG + Intergenic
1139375493 16:66494026-66494048 CTGGGGGTATAGTGGGTGCTGGG - Intronic
1139576411 16:67845200-67845222 CTGGGTTTACTGTGGGTGGTGGG + Intronic
1139740494 16:69031306-69031328 CTTGGCACATAGTGGATGCTAGG + Intronic
1139805313 16:69560332-69560354 CTTGTTCCACAGTGGGTGCCGGG - Intergenic
1140870442 16:79101532-79101554 GTGGGTCTACAGTGGGTCCTGGG + Intronic
1140956826 16:79874160-79874182 TTTGGCATACAGTGGGTGCTTGG + Intergenic
1141135822 16:81464692-81464714 ATGGGTACAGAGTTTGTGCTGGG - Intronic
1141798569 16:86291610-86291632 CTGGGTTCACAGTGGGTGGCAGG - Intergenic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142144345 16:88486617-88486639 CTGGGTGCACAGTGGGTACTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144357 16:88486675-88486697 CTAGGTACACAGTGGGTGCTGGG + Intronic
1142144366 16:88486710-88486732 CTGGGGGCACAGTGGATGCTGGG + Intronic
1142144374 16:88486750-88486772 CTGGGTGCACAGTGGATACTGGG + Intronic
1142144381 16:88486785-88486807 CTGGGTGCACAGTGGATGCTGGG + Intronic
1142144388 16:88486825-88486847 CTGGGTGCACAGTGGATGCTGGG + Intronic
1142201450 16:88762920-88762942 CTGGGTATAAGGTGGGGGCTCGG - Intronic
1142358502 16:89615318-89615340 CTCTGTACCCAGTGGGAGCTGGG - Intronic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1142624613 17:1183792-1183814 CTGAATACACAGTGGGTGGGAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143372090 17:6446784-6446806 CTTGGTGTACAGGGGGTGCTGGG + Intronic
1144769754 17:17752918-17752940 CCTGGCACACAGTAGGTGCTCGG + Intronic
1144773762 17:17773673-17773695 CTGGGTACCCTCTGTGTGCTGGG - Intronic
1144848841 17:18233956-18233978 CCGGGCACACAGTGGGTGCTGGG - Intronic
1145815433 17:27791955-27791977 ATGGGTGCAGGGTGGGTGCTGGG - Intronic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1147979966 17:44268241-44268263 CTGGGCACCCAGTGGGAGCGGGG - Intergenic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148578315 17:48726608-48726630 CTGGGTACCCAGTATGTGCAGGG - Exonic
1150128049 17:62651454-62651476 CTGGGTCCTCAGTGGGCACTTGG + Intronic
1152037253 17:77881025-77881047 CTTGGCACACAGTAGGTGCACGG + Intergenic
1153281001 18:3414300-3414322 CTGGGTTCACAGTAAGTGTTAGG - Intronic
1154134748 18:11766469-11766491 CTGGGGACTCTGGGGGTGCTGGG - Intronic
1155449332 18:25946981-25947003 CAGGACACACATTGGGTGCTGGG + Intergenic
1156030256 18:32704849-32704871 CTGTCTACACAGTGGGCTCTGGG - Intronic
1156290952 18:35748209-35748231 CCTGGCACACAGTAGGTGCTTGG - Intergenic
1156497284 18:37534268-37534290 CTGGCTGCATACTGGGTGCTGGG + Intronic
1158006646 18:52680110-52680132 CTGGGTGCCCATTGGGTTCTTGG + Intronic
1159092945 18:63870058-63870080 CAGGGCACTCACTGGGTGCTGGG + Intergenic
1159304081 18:66616619-66616641 CTAGGCACACCTTGGGTGCTTGG + Intergenic
1159570825 18:70110382-70110404 CTGGTTGGACAGTGGGTGCAGGG + Intronic
1159861990 18:73660394-73660416 TTGGTTACTCAGTGGGAGCTTGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160677534 19:399418-399440 GTGGGGACACAGTGGCTGGTGGG + Intergenic
1161124418 19:2547759-2547781 CTGGGAACAGAGTGGGTTCCAGG - Intronic
1161148665 19:2695161-2695183 GTGGGTACACAGAGGGCGCTAGG - Intronic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1161731644 19:5964458-5964480 CTTAGTGCACAGTGGGTGCTGGG - Intronic
1162367113 19:10256476-10256498 CCGGGCACGCAGGGGGTGCTCGG - Intronic
1162575693 19:11497559-11497581 CTGGGCACACAGTGAGTGCTGGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163250826 19:16125359-16125381 CTGGCTGTGCAGTGGGTGCTGGG + Intronic
1163303645 19:16463488-16463510 CTGCTTACACAGGGAGTGCTTGG - Intronic
1163990528 19:20995106-20995128 CTGGGTGCACACTGCGTGCAGGG - Intergenic
1164582575 19:29443457-29443479 ATGGTTACACAGTGGATTCTTGG - Intergenic
1164593900 19:29521037-29521059 TCGGGTACACAGAGTGTGCTGGG + Intergenic
1164713758 19:30376910-30376932 CTGTGTGCACAGTGGGTACGGGG + Intronic
1165112089 19:33508346-33508368 CTGGGTAGAGAGGGGATGCTGGG + Intronic
1165436151 19:35796678-35796700 CTCGGGACACAGTCGGTGTTCGG + Intergenic
1165717531 19:38056095-38056117 CCGGGTACCTGGTGGGTGCTGGG - Intronic
1165863932 19:38924513-38924535 CTGGCCACTCAGTAGGTGCTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166315173 19:41985536-41985558 CTGGGTGCCCAGTGGGTGAGTGG + Intronic
1166564730 19:43756840-43756862 CCTGGTACACAGTGGGTCCAAGG - Intergenic
1167490745 19:49791651-49791673 ATGGGCACCCAGTAGGTGCTTGG + Intronic
1168188075 19:54714049-54714071 CAGGGTCCAGAGAGGGTGCTAGG - Intergenic
1168268667 19:55237753-55237775 CTGGGCACACAGTGGGTCTAGGG + Intronic
1168388052 19:55982575-55982597 CTGACTCCACAGTTGGTGCTGGG + Intronic
925811255 2:7702926-7702948 CAGAGTACCCAGTGGGTGCCAGG + Intergenic
925852335 2:8094661-8094683 CAGGGTAGACAGTGTGGGCTTGG - Intergenic
925929969 2:8699047-8699069 CGGGGTGCACAGTGTTTGCTGGG - Intergenic
926225138 2:10961753-10961775 CTGTGTTCGAAGTGGGTGCTGGG - Intergenic
926679545 2:15653233-15653255 CTGGGTTCCCAGGGTGTGCTAGG - Intergenic
926697793 2:15782782-15782804 CGGGGTACCCAGAGGCTGCTTGG + Intergenic
926736422 2:16076758-16076780 CTAAGTACACAGTAGGTTCTTGG - Intergenic
927613667 2:24566940-24566962 CTGGGTCCACAGTGGTGGATGGG + Intronic
927647288 2:24886153-24886175 CTGGGAACACAGTGGGGACTGGG - Intronic
929885024 2:45870846-45870868 CTGGGCACATAGTGAGCGCTTGG + Intronic
932590419 2:73062962-73062984 CTGGGCACACAGTAGATCCTCGG - Intronic
934078585 2:88448711-88448733 ATGGCTCCACAGTGGCTGCTGGG - Exonic
936182000 2:110275106-110275128 CTGGGACCACAGTGGGGGCCTGG + Intergenic
936230569 2:110696567-110696589 CTGGGACCACAGTGGGGGCCTGG - Intergenic
939639848 2:144627318-144627340 CTGAGTACCAACTGGGTGCTGGG + Intergenic
939813628 2:146867250-146867272 CTGGGTACGCTGTGGGTACTAGG + Intergenic
946457732 2:219841641-219841663 CTAGGCACACAGTGGGTGATGGG + Intergenic
946459415 2:219855930-219855952 CTGGGTATATAGTAGCTGCTTGG - Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948454760 2:238099835-238099857 CTGGGGACACAGTGGCTCCACGG - Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1168989270 20:2080301-2080323 CTGGGAACACAGGTGCTGCTGGG + Intergenic
1169193453 20:3671585-3671607 CTAGGTCCACACTGGGTGCCTGG + Exonic
1169300465 20:4437729-4437751 CCTGGCACACAGTCGGTGCTGGG - Intergenic
1169402777 20:5297204-5297226 GTGGGTACACAGTAGATGTTTGG - Intergenic
1169608555 20:7352090-7352112 CTTGGTATACAGTAGATGCTAGG + Intergenic
1171284264 20:23924466-23924488 CTGGATTCACAGTGGGTGAGAGG - Intergenic
1171796322 20:29569287-29569309 CAGGGTAGACAGTGGGGTCTTGG + Intergenic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1171986351 20:31664274-31664296 CTGGGTACATGCTGTGTGCTGGG - Intergenic
1172780632 20:37435000-37435022 ATGGGTACACGGTGGGTGGGAGG - Intergenic
1172814367 20:37674518-37674540 CTTGGCACAGAGTAGGTGCTCGG - Intergenic
1173261995 20:41444708-41444730 CTTGGTACATAATAGGTGCTGGG - Intronic
1173462361 20:43253461-43253483 CTTGGTACACAGTAGGTGGCTGG - Intergenic
1174113519 20:48212220-48212242 CCTGGTACACAGCAGGTGCTTGG - Intergenic
1174615230 20:51830282-51830304 CTGGGTACCCGCTGGGTGCCTGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175165150 20:57038322-57038344 CTTGGCACACAGTAGGAGCTCGG - Intergenic
1175765073 20:61586898-61586920 CTTAGTACACAGTAGGTACTCGG - Intronic
1176185932 20:63779023-63779045 CTGGGAGCAGAGTGGGTGGTGGG + Intronic
1176274035 20:64253650-64253672 CTGGCTACTCAGTCCGTGCTGGG - Intergenic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1179032968 21:37736162-37736184 CTCGGTACACAGGAGGTGCCTGG - Intronic
1179478969 21:41665896-41665918 CTTGGCACACAGTGGGTGGGTGG + Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1181338739 22:22161965-22161987 CTGGGTCCTCTCTGGGTGCTTGG + Intergenic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1181859671 22:25808536-25808558 GTGGGTACATTCTGGGTGCTAGG + Intronic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183438662 22:37810154-37810176 CCAGGTACACAGTGAGTGGTGGG + Exonic
1183492829 22:38125942-38125964 CTAGGTATACAGCAGGTGCTGGG + Intronic
1184150689 22:42636647-42636669 CTGAGCACAGAGTAGGTGCTGGG + Intronic
1184267944 22:43359932-43359954 CTTGGCATATAGTGGGTGCTTGG - Intergenic
1184464667 22:44661679-44661701 CTTGGCACACCGTAGGTGCTTGG - Intergenic
1184487056 22:44786103-44786125 TAGAGTACACAGTGGGTGCATGG + Intronic
950681111 3:14585716-14585738 CCTGGTATGCAGTGGGTGCTTGG - Intergenic
952311244 3:32192447-32192469 CTGGGTTCTCACTGGGTTCTGGG - Intergenic
953205673 3:40826564-40826586 CTGGGTAGCCAGTGGCTGCTGGG + Intergenic
953580907 3:44155539-44155561 CTTGGTAGACAGTTGGTCCTTGG - Intergenic
954214138 3:49115151-49115173 CTGGGTGTGCAGTGGGTGCTAGG - Intronic
954369278 3:50161798-50161820 CCTGGTACACAGCAGGTGCTGGG - Intronic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
959516143 3:107269277-107269299 CTGGGCACACTGTGGGTGTGAGG + Intergenic
960922401 3:122760788-122760810 CTTGGAACACACTGGCTGCTTGG + Intronic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
962342423 3:134596696-134596718 CTCGGCACACAGTAGGTGTTTGG - Intergenic
962977247 3:140456433-140456455 CTGGGCACAGAATGGGTGCCAGG - Intronic
963726998 3:148934103-148934125 ATTGGTAACCAGTGGGTGCTTGG + Intergenic
963785654 3:149531855-149531877 CTAGGCATACAGTGGGTACTTGG + Intronic
964050143 3:152381972-152381994 CTGGGGACATAGTAGGTGTTTGG + Intronic
966210498 3:177448318-177448340 TTGGGTACACAGTGGTTGTGTGG + Intergenic
968520393 4:1032400-1032422 CTGGGGGCACAGTGGCTGCTGGG + Intergenic
970353811 4:15232780-15232802 CTTAGTACACAGTGGGTGCTAGG - Intergenic
972317179 4:37937751-37937773 CTGGGAATAAAGTGGCTGCTTGG + Intronic
972345219 4:38187136-38187158 CTCGGTACACATTGTTTGCTGGG + Intergenic
978406985 4:108390523-108390545 CGGAGAACACAGTGGTTGCTAGG + Intergenic
981042662 4:140237761-140237783 CTGGCTGCACATTGGCTGCTGGG - Intergenic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
989003636 5:36786444-36786466 CTGGTTACACAATGTGTGGTGGG - Intergenic
989550266 5:42726746-42726768 CTTGGTGCACAGTAGGTGCTTGG - Intergenic
990799121 5:59579706-59579728 CTGGGTACACACTTGGTGTGTGG - Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
993110154 5:83646761-83646783 CTGGGAACCCAGTGAGTGCTGGG + Intronic
994446463 5:99880053-99880075 CTTGGTAAACACTGGGTGGTAGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
997349945 5:133223517-133223539 GTGGGGACACAGTGGGGACTGGG + Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997920553 5:137975301-137975323 CAGGGTACAGAGTGCGTGTTGGG - Intronic
998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG + Intronic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
999367920 5:151034915-151034937 ATGGATGCACAGTGTGTGCTCGG - Intronic
1001289803 5:170448811-170448833 TTTGGTACATAATGGGTGCTGGG - Intronic
1001427072 5:171629647-171629669 CCTGGCACATAGTGGGTGCTGGG + Intergenic
1001518467 5:172373715-172373737 CCTGGTGCACAGTTGGTGCTCGG + Intronic
1001651166 5:173317471-173317493 TGGGCCACACAGTGGGTGCTGGG - Exonic
1004595232 6:17093445-17093467 CAGGGTACACAGTTGGCCCTTGG - Intergenic
1004883093 6:20028006-20028028 CTGGGTACAGGGTGGGGACTTGG - Intergenic
1005094964 6:22104452-22104474 CTGGGCAGACAGTGAGTCCTGGG - Intergenic
1007020975 6:38521093-38521115 GTGGGTACACAGTGTGTGTAAGG - Intronic
1007061192 6:38942363-38942385 CTGGGTCCACAGTGGATGGTGGG + Intronic
1007159582 6:39778216-39778238 CTTGGCACACAGTGACTGCTCGG + Intergenic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007603550 6:43099545-43099567 CTAGGTACCCAGTAGGTACTAGG + Intronic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1010449698 6:75988823-75988845 CTGGGGACACAGTGGCTTCCTGG - Intronic
1011687247 6:89833322-89833344 CTGGGGATACAGTGAGAGCTGGG + Intronic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1015930502 6:138354714-138354736 CTGGGAACACGGTGGGAGCCTGG - Intergenic
1018029415 6:159830352-159830374 CTGGGTGGATGGTGGGTGCTGGG - Intergenic
1018375529 6:163207650-163207672 CTGGGCACACGCTGAGTGCTGGG - Intronic
1019306857 7:339751-339773 CTGGGCACTGAGTGTGTGCTGGG - Intergenic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019620011 7:1987306-1987328 CCTGGCACACAGTCGGTGCTTGG + Intronic
1019709136 7:2510435-2510457 CTGAGTACTCTGTGGGTGCCGGG + Intergenic
1022123396 7:27332310-27332332 CTGGGTACAGAGTGGGAACTGGG - Intergenic
1023991846 7:45133270-45133292 CTGGGCACACAGGAGCTGCTGGG - Intergenic
1024295146 7:47835894-47835916 CCTGGTAGAGAGTGGGTGCTCGG - Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026523620 7:71136368-71136390 CTTGGTACAGAGTGGGAGCCAGG + Intronic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029180004 7:98693534-98693556 CTGGGTGCACCGTGGGTACAGGG + Intergenic
1029449392 7:100632430-100632452 CTGGGAACAAATTGGGTGTTGGG - Intronic
1031925047 7:127631035-127631057 ATGGGTACAGAGTGTCTGCTTGG - Intergenic
1032154765 7:129458800-129458822 CTGGCTACAGAGTGGTTCCTAGG + Intronic
1033873106 7:145781627-145781649 CTGTGTACCTAGTGTGTGCTCGG + Intergenic
1035445919 7:158943319-158943341 CCAGGCACACAGTCGGTGCTGGG - Intronic
1036701774 8:11017861-11017883 CTGAGATGACAGTGGGTGCTGGG + Intronic
1036768039 8:11561227-11561249 CGGGGGACACAGTGTGGGCTCGG + Intronic
1037616153 8:20520516-20520538 GTGGGTCCACAGTGGGTACCTGG - Intergenic
1038687148 8:29729035-29729057 CAGGGAGCACAGGGGGTGCTGGG - Intergenic
1039469797 8:37806260-37806282 CTGAGTGCACAGTGGCTGTTAGG + Intronic
1039484706 8:37901291-37901313 CTGGGTGCACAGTAGGTACCCGG + Intergenic
1040425890 8:47285875-47285897 CTGGGTGCCCACTGTGTGCTAGG - Intronic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1041305073 8:56449108-56449130 CTTGGGGCACAGTGGTTGCTTGG + Intergenic
1041539434 8:58966505-58966527 CTGGGTACAGTGCGGCTGCTTGG + Intronic
1041688678 8:60668063-60668085 ATGGGTACACAGTGTCTGTTGGG + Intergenic
1042835340 8:73074785-73074807 GAGGGCACACAGTGGGTGCAGGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1046009761 8:108532099-108532121 CTAGATACATAGTAGGTGCTTGG + Intergenic
1046684349 8:117208183-117208205 ATGGGTGCACAGTGTGTCCTTGG - Intergenic
1046827777 8:118710684-118710706 CTCAGTACATAGTAGGTGCTTGG - Intergenic
1048867182 8:138769709-138769731 CTGGGTACCCGCTGTGTGCTGGG - Intronic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049154506 8:141058680-141058702 AAGGGTCCAGAGTGGGTGCTTGG - Intergenic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1053120412 9:35542639-35542661 CTTGGAACACAGTAGGTGCCTGG - Intronic
1053140424 9:35679358-35679380 GTGTGGACACAGTGGGTGCGGGG + Intronic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1053352702 9:37424119-37424141 CTCAGTACAAAGTGGGTCCTTGG - Intronic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054946994 9:70806072-70806094 CTGGGTTCACATGGGGTACTGGG - Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1056556744 9:87695645-87695667 CTGCCTACACAGGAGGTGCTTGG - Intronic
1057115054 9:92513145-92513167 GTGGGGACACTTTGGGTGCTGGG - Intronic
1057206365 9:93175372-93175394 CTGGGCACTCAGTGTGTGCTAGG - Intergenic
1057489313 9:95509025-95509047 CTGGGTTCGCGGTGGCTGCTCGG + Intronic
1058039076 9:100284414-100284436 CTGGGCACATCCTGGGTGCTAGG - Exonic
1058342885 9:103920241-103920263 CTGGGGCCACTGTGGGTGATGGG - Intergenic
1059392705 9:114008940-114008962 CCTGGTACATAGTAGGTGCTCGG + Intronic
1059408741 9:114118722-114118744 CTGGGGACACTGGAGGTGCTGGG + Intergenic
1059434945 9:114270575-114270597 CCTGGCACACAGTGGGTGCATGG - Intronic
1060269199 9:122129005-122129027 CTGGGCACCCAGTCGGTACTTGG + Intergenic
1060387215 9:123242001-123242023 CTAGGGACACAGTGGGTGTGTGG - Intronic
1060738408 9:126081268-126081290 CTGGATCCACTGTGGGTTCTGGG + Intergenic
1060747132 9:126145149-126145171 CTGGGTCCAAAGTGTGTGTTTGG - Intergenic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061033209 9:128099270-128099292 CTTGGTGCACAGTGGGCACTGGG - Intronic
1061322600 9:129840402-129840424 CTGGAGGCTCAGTGGGTGCTGGG + Intronic
1061404372 9:130385370-130385392 CTGGTCACTCAGTGGGTCCTTGG + Intronic
1061477982 9:130881706-130881728 CTGGGTTCACAGAGGATCCTGGG + Intronic
1061884932 9:133586628-133586650 CAGGGCACACAGTGTGTGTTTGG + Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1188839670 X:35000969-35000991 CTGGGTCCTCAGTGTGTGTTGGG + Intergenic
1190840750 X:54142230-54142252 CTTGTTGGACAGTGGGTGCTGGG + Intronic
1192552124 X:72062832-72062854 CCTGGAACAGAGTGGGTGCTTGG + Intergenic
1194765457 X:97842916-97842938 CTGGGGACAGAGTGGATGTTAGG - Intergenic
1195212283 X:102661177-102661199 CTTGGTACCCAGTGGATGCATGG - Intergenic
1195218325 X:102721926-102721948 CTTGGTACCCAGTGGGTGCATGG - Intronic
1196631933 X:117951761-117951783 CTTAGTACACAGCAGGTGCTGGG - Intronic
1198710200 X:139493217-139493239 CTGGGCACTCAGTGGGTTTTAGG - Intergenic
1199495856 X:148451515-148451537 GTGGGTCCCCAGTGAGTGCTTGG - Intergenic
1199715367 X:150503951-150503973 CTTGGCACCTAGTGGGTGCTCGG + Intronic
1200236829 X:154471834-154471856 CTGGGTACAAAGTGGCCACTGGG + Intronic