ID: 1142144480

View in Genome Browser
Species Human (GRCh38)
Location 16:88487197-88487219
Sequence GTGAGCATGCTGACCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142144480_1142144491 21 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144491 16:88487241-88487263 AGAGACAGCAGCAGGTTGTGGGG 0: 1
1: 0
2: 1
3: 44
4: 401
1142144480_1142144493 25 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144493 16:88487245-88487267 ACAGCAGCAGGTTGTGGGGTGGG 0: 1
1: 0
2: 3
3: 58
4: 559
1142144480_1142144487 13 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144487 16:88487233-88487255 GGTCCGAGAGAGACAGCAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 214
1142144480_1142144489 19 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144489 16:88487239-88487261 AGAGAGACAGCAGCAGGTTGTGG No data
1142144480_1142144492 24 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144492 16:88487244-88487266 GACAGCAGCAGGTTGTGGGGTGG 0: 1
1: 0
2: 4
3: 45
4: 446
1142144480_1142144481 -8 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144481 16:88487212-88487234 ATGCTCACCCCCATTTTCCAAGG 0: 1
1: 0
2: 2
3: 16
4: 244
1142144480_1142144490 20 Left 1142144480 16:88487197-88487219 CCAGGAGAGGTCAGCATGCTCAC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1142144490 16:88487240-88487262 GAGAGACAGCAGCAGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142144480 Original CRISPR GTGAGCATGCTGACCTCTCC TGG (reversed) Intronic
903882661 1:26522142-26522164 GTGTGCACACTGAGCTCTCCTGG + Intergenic
904412987 1:30336148-30336170 GTGAGTTGGCTGCCCTCTCCAGG + Intergenic
904802337 1:33102526-33102548 GTTTTCATGCTCACCTCTCCTGG + Intronic
906688906 1:47779854-47779876 GTCAGCATGCTGACAGCCCCAGG + Intronic
908784696 1:67723330-67723352 GTGAGGATGTTGCCCTGTCCAGG - Intronic
911856558 1:102884612-102884634 GTGAGCATGCGCACAGCTCCAGG + Intronic
912473834 1:109923603-109923625 GTCTGCATGCTGCCCCCTCCTGG - Exonic
916722099 1:167492282-167492304 CTGAGCCTGCTGACCTCTTCCGG - Intronic
918462986 1:184795296-184795318 GTGAGTGTGCAGGCCTCTCCTGG + Exonic
924101587 1:240608912-240608934 GTTTGCATGCTGCCCTCTCCTGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1064092087 10:12394243-12394265 GGGAGCGTGCCGTCCTCTCCGGG + Intronic
1069794435 10:71043150-71043172 GAGACCATGCTGTGCTCTCCAGG + Intergenic
1070746676 10:78937899-78937921 GCGAGGGTGCTGCCCTCTCCCGG - Intergenic
1073478486 10:103770495-103770517 TTGAGAATGCTGACGTGTCCTGG - Intronic
1073785070 10:106879911-106879933 GTGAGCAAGCTGAGCTCATCTGG + Intronic
1075418325 10:122282089-122282111 GTGAGCACACTGCCTTCTCCTGG - Intronic
1083744703 11:64728944-64728966 GTGAGGGTGCAGACCCCTCCAGG + Exonic
1084683167 11:70678987-70679009 GCGAGCATGCTGAGATCCCCTGG - Intronic
1084793765 11:71490968-71490990 GTGAGCACACTCACCTCTGCAGG - Exonic
1084930434 11:72551456-72551478 ATGATAATGCTGACCTCTCTGGG + Intergenic
1085151503 11:74255962-74255984 GTGATCATGCTGCCCTCTTGTGG - Intronic
1087102708 11:94380713-94380735 CTGAGCCAGCTGACCTCTTCTGG - Exonic
1087508923 11:99065286-99065308 AGGAGCATGCTGTTCTCTCCAGG + Intronic
1088727235 11:112650143-112650165 GTGAGCTTGCTGCACTCACCAGG - Intergenic
1088820453 11:113452206-113452228 GAGAGCATGACAACCTCTCCAGG + Intronic
1092895975 12:13010717-13010739 GTGGGCATGCTCCCCTCTTCAGG + Intergenic
1100800853 12:98228693-98228715 GTGAGCATGCTTTTCTCTGCGGG - Intergenic
1101182110 12:102230438-102230460 GTGATGATGCTGAAATCTCCAGG + Intergenic
1102024633 12:109707322-109707344 GAGAGCCTGCTGGCCTTTCCAGG + Intergenic
1105202851 13:18194579-18194601 GGGGCCGTGCTGACCTCTCCCGG - Intergenic
1113093934 13:106643578-106643600 GCCAGCATGTTGACCTCTCAAGG + Intergenic
1118257761 14:64220188-64220210 GAGACCCTGCTGACCTCTACAGG - Intronic
1120652807 14:87155054-87155076 GTGAGCATGCGTACAACTCCAGG + Intergenic
1121440666 14:93947214-93947236 ATGTCCATTCTGACCTCTCCTGG + Intronic
1121713531 14:96056578-96056600 GTGGGGATAATGACCTCTCCTGG + Intronic
1122350225 14:101084708-101084730 GTGAGAAGGCTCATCTCTCCCGG - Intergenic
1128229902 15:66027140-66027162 GTGAGCTTGCTGGCCTGGCCAGG - Intronic
1128819020 15:70635563-70635585 GTGGGAATTCAGACCTCTCCTGG - Intergenic
1129771141 15:78204331-78204353 CTGAGCATGCTCACCTTTACAGG - Intronic
1130083343 15:80754851-80754873 GTTAACATGCTGATCTTTCCCGG + Exonic
1130854474 15:87829431-87829453 TTGAGGATGCAGACCTTTCCAGG + Intergenic
1133088270 16:3382682-3382704 ATAAGGACGCTGACCTCTCCTGG - Exonic
1133645621 16:7761763-7761785 GTGAGTATCCTGAGCTCTCTCGG - Intergenic
1135276871 16:21120760-21120782 GCGTGCATGCTGGGCTCTCCTGG + Exonic
1136340778 16:29641727-29641749 GTAATGATGCTGCCCTCTCCAGG - Intergenic
1136923067 16:34347001-34347023 GGGAGCATGCCCACCTCGCCAGG + Intergenic
1136981506 16:35064805-35064827 GGGAGCATGCCCACCTCGCCAGG - Intergenic
1137250417 16:46736997-46737019 GTGAGCCTGCTGAAAGCTCCTGG + Intronic
1138290565 16:55843000-55843022 GTGATAATGCTGCCCTCTACTGG + Intergenic
1139775183 16:69312102-69312124 CTGAGCATGTTGATCTCTTCTGG - Intronic
1141666288 16:85467135-85467157 GCGAGCATGCAGACCTCTGCTGG + Intergenic
1142144480 16:88487197-88487219 GTGAGCATGCTGACCTCTCCTGG - Intronic
1142319281 16:89370637-89370659 GGGAGGATGCTGAGCTCACCTGG - Intronic
1142391695 16:89805293-89805315 GCCAGCATGCTGACGTCGCCAGG - Exonic
1143054802 17:4154852-4154874 GGGAGCCTGCTTACCTCTTCTGG - Exonic
1144752334 17:17657808-17657830 CTGAGCCTGCTCACCCCTCCTGG + Intergenic
1147887955 17:43697282-43697304 GAGAGCACGCTGCCCTCTCTGGG - Intergenic
1148832189 17:50440835-50440857 GTGAGCCAGCTCACCTCTCCTGG - Intronic
1151725699 17:75882619-75882641 GTGAACATGCTGAGCTCACATGG - Intronic
1152667255 17:81578237-81578259 GGGTGCATGCTGTGCTCTCCAGG + Intronic
1153469526 18:5428299-5428321 GTGGGTATACTTACCTCTCCCGG + Exonic
1153724316 18:7939992-7940014 CTGAACACACTGACCTCTCCAGG + Intronic
1156456537 18:37297905-37297927 GTTAGCAGGCTGCCTTCTCCAGG + Intronic
1157539470 18:48489597-48489619 GTTAGCCTCCTGCCCTCTCCTGG - Intergenic
1157643556 18:49243161-49243183 GTGAGCGGGCTGCCTTCTCCTGG + Intronic
1160137210 18:76282587-76282609 CTGAGCATGTTGACTTTTCCAGG + Intergenic
1161347875 19:3777163-3777185 GTGAGCAACCTGCCCTCTCTGGG + Intergenic
1163290793 19:16377834-16377856 GTGGGCATGCTGACCAGTGCGGG - Intronic
1165235936 19:34421631-34421653 TTGAGCATGCTGACCAGTGCTGG - Exonic
1165341372 19:35214480-35214502 GTGAGCTTGCTGGGCTGTCCTGG + Intergenic
1167449302 19:49557470-49557492 GTGAGCACTATGACCTCTCCTGG + Intronic
925754948 2:7124359-7124381 GTGAGCAGGCTGGCCGCCCCAGG + Intergenic
925844156 2:8020537-8020559 GTGAGGATGCTGAGGCCTCCAGG + Intergenic
928935968 2:36678271-36678293 GAGGGCATGGTGACCTCTGCAGG + Intergenic
934165656 2:89291899-89291921 CTGAGCATGCTCACCTCCCAAGG + Intergenic
934201621 2:89890557-89890579 CTGAGCATGCTCACCTCCCAAGG - Intergenic
935163614 2:100550264-100550286 TTTAGCATCCTGACCTTTCCTGG - Intergenic
938238660 2:129725893-129725915 CTGAGCTTGCTAACATCTCCCGG - Intergenic
939043074 2:137215502-137215524 GAGGGCATGCAGAGCTCTCCAGG - Intronic
943063669 2:183064262-183064284 GTGACCATTTTGACCTCTCTAGG - Intergenic
943181917 2:184555592-184555614 GTGAGCATACTGACCACAACCGG - Intergenic
947789673 2:232857551-232857573 CTGAGCAAGCTGATCTCCCCTGG + Exonic
947910202 2:233795742-233795764 CTGAGCTTGCTGGCCTCACCTGG - Exonic
948336925 2:237216446-237216468 GTTAGCATGCTGAACACTGCAGG - Intergenic
948337153 2:237218343-237218365 GTCAGAATGCTGACTTCTGCTGG - Intergenic
948704459 2:239780258-239780280 GTGAGCATGCTCACTATTCCGGG - Intronic
948795721 2:240401202-240401224 GTCAGCTTCCTGACCTTTCCAGG - Intergenic
1170797471 20:19561537-19561559 ATAAGCCTGCTGACCTTTCCTGG + Intronic
1170817236 20:19724148-19724170 CTGAGCAGGCTGAACTCCCCAGG + Intergenic
1170933788 20:20792537-20792559 GCAAGCATGCTGACCTGTCCTGG + Intergenic
1171349425 20:24491321-24491343 TTGAGCATCCTGTCCTCTCCTGG - Intronic
1171446359 20:25207263-25207285 GTGGGCCTGCTGACCCCACCGGG - Exonic
1171727316 20:28636890-28636912 GTGAGCTTTCTGTCCTCTGCAGG - Intergenic
1172361086 20:34312827-34312849 GGGAGCAGGGTGCCCTCTCCTGG - Intergenic
1172704061 20:36870224-36870246 ATCAGCATGGTGACCTCCCCCGG + Intergenic
1175389484 20:58617652-58617674 GTGAGGGTGAGGACCTCTCCTGG - Intergenic
1175519130 20:59588475-59588497 GAGAGCAGATTGACCTCTCCTGG - Intronic
1176715105 21:10343426-10343448 GGGGCCGTGCTGACCTCTCCCGG + Intergenic
1179876008 21:44267867-44267889 GTGAGGCTGCTGACGTCTGCAGG - Intergenic
1180603242 22:17036512-17036534 GGGGCCGTGCTGACCTCTCCCGG - Intergenic
1181555739 22:23670838-23670860 GTGTGCATGCTGTCCAGTCCTGG + Intergenic
1182141140 22:27959496-27959518 GTGACTCTGCTGACCTCTCAAGG + Intergenic
1182863743 22:33583979-33584001 GTGGGCATCCTGACCAGTCCTGG + Intronic
1183236740 22:36624421-36624443 GTGAGCAGCCTGACCTCTCTGGG - Intronic
1184713879 22:46269189-46269211 TTGAGGATGCTGGCCTCCCCGGG + Intronic
1184791722 22:46704098-46704120 GGGTGCCTGCTGTCCTCTCCTGG + Intronic
1185126087 22:49011631-49011653 GCCAGCATGCTGGCCTCTGCTGG + Intergenic
949634112 3:5963812-5963834 GTGTGCATGGTAACCTCTGCTGG - Intergenic
953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG + Intronic
953481615 3:43256956-43256978 GTGGCCTTGCTGACCTCTTCAGG - Intergenic
954151086 3:48657456-48657478 GTCAGCAGGCTGACCCCACCAGG + Intronic
954956926 3:54529482-54529504 CTGAGCATGCTGACATCAGCGGG + Intronic
956342440 3:68240732-68240754 GAGTGCATGCTGACCTCTGAAGG - Intronic
957041988 3:75342640-75342662 GTGCCCATGGTGACCGCTCCAGG + Intergenic
960584456 3:119308212-119308234 ATGACCATGCTGGCCTCTCTGGG + Intronic
960789444 3:121412113-121412135 ATAAGGATGCTGACCTCTCCTGG + Intronic
961046716 3:123713461-123713483 GTGCCCATGGTGACCGCTCCAGG + Intronic
963867177 3:150374973-150374995 GTGATCATGCTGCCCTCTCAGGG + Intergenic
968503643 4:962205-962227 CTGCCCATGCTGCCCTCTCCTGG - Intronic
968900472 4:3429147-3429169 GTGGGCTTGCTGAGCTCTCTTGG + Intronic
969443893 4:7233330-7233352 GTCATCATGATGACGTCTCCTGG + Intronic
969726480 4:8921150-8921172 GTGAGCCTGGGGACCTCCCCGGG + Intergenic
969929966 4:10621246-10621268 GTTACCATTCTGCCCTCTCCAGG - Intronic
974699516 4:65422268-65422290 GTGGGGATGCTGACAACTCCTGG + Intronic
975733207 4:77357424-77357446 GTGAGCATGGTGATCACTCCTGG + Intronic
976351890 4:84069371-84069393 TTGGGCATGCTCTCCTCTCCTGG + Intergenic
980590116 4:134875678-134875700 GGAAGCCTGCTGACCTCTCTAGG - Intergenic
980897812 4:138876495-138876517 GCGAGCCTTCTCACCTCTCCGGG + Intergenic
981850009 4:149218862-149218884 GTTGGTCTGCTGACCTCTCCAGG + Intergenic
984329580 4:178297794-178297816 GTGAACATGCTCACAGCTCCAGG - Intergenic
984814673 4:183825359-183825381 GTGTGAAGGCTGACCGCTCCCGG - Intergenic
984954164 4:185029272-185029294 GTGAGCATGTTCACCTTTCTGGG - Intergenic
986131464 5:4936062-4936084 ATGAGCATGCAAGCCTCTCCTGG - Intergenic
986501939 5:8409841-8409863 GTGAGCACGCAGGCATCTCCTGG - Intergenic
994138966 5:96321065-96321087 GTGAGAGTGCTTATCTCTCCAGG + Intergenic
994223983 5:97230530-97230552 GTGAGTATGCTGAATTCTCCTGG + Intergenic
994412792 5:99430455-99430477 GTGAGCAGGCCCAGCTCTCCAGG - Intergenic
994481049 5:100335268-100335290 GTGAGCAGGCCCAGCTCTCCAGG + Intergenic
994835572 5:104848337-104848359 GTGAGCAAGCTGACCCTTCTGGG - Intergenic
995026262 5:107426768-107426790 GTCAACATGCTGACATGTCCAGG + Intronic
996403462 5:123086586-123086608 GTGAGGATGCCGAGCTCTGCGGG + Intergenic
996817028 5:127585673-127585695 GTGAGCGAGCTGACCCCTCTGGG - Intergenic
1002637048 5:180613696-180613718 GCGAGCATGATGAAGTCTCCAGG - Intronic
1003968772 6:11278774-11278796 GGCAGCATGCTGAAATCTCCTGG - Intronic
1006001223 6:30966677-30966699 GTGAGCAAGCTGATCTCCCTTGG + Intergenic
1006441305 6:34055423-34055445 GGGAGCATGCTGCCCTCTGGTGG - Intronic
1007221516 6:40282606-40282628 GCCAGCAAGCTCACCTCTCCGGG - Intergenic
1011997831 6:93615521-93615543 GTGAGTATGCTGATTCCTCCTGG - Intergenic
1012079493 6:94737111-94737133 GTGCCCATGCTGAGCTCTCATGG - Intergenic
1015826200 6:137314465-137314487 TTGAGGATGCTGCCCTCTCGTGG + Intergenic
1015966208 6:138697141-138697163 GGGAGCTTGCTGGCTTCTCCTGG - Intergenic
1018415908 6:163601889-163601911 GTGAGGATGTGGACCTCTCTGGG + Intergenic
1018676419 6:166226254-166226276 TTCACCATGCGGACCTCTCCTGG - Intergenic
1021669797 7:23023713-23023735 TGGATCAAGCTGACCTCTCCTGG + Intergenic
1023073390 7:36459695-36459717 GTGAGCATGCAGACCTGCACTGG + Intergenic
1024074565 7:45811930-45811952 GGGCTCATGCTGACCTCTCTTGG - Intergenic
1024206665 7:47168512-47168534 CTGAGCATGCTAACCTGACCAGG + Intergenic
1024627204 7:51218078-51218100 GAGAGCAGGCTGGCCTCACCTGG + Intronic
1025052490 7:55742273-55742295 GGGCTCATGCTGACCTCTCTCGG + Intergenic
1025129761 7:56369199-56369221 GGGCTCATGCTGACCTCTCTCGG + Intergenic
1028460758 7:91089543-91089565 CAGAGCATGCTGCCCTCTACAGG - Intronic
1030102709 7:105960611-105960633 GCCAGCATGCTGAGCTGTCCTGG - Intronic
1033882707 7:145905642-145905664 TTGAGCAGGCTGTCTTCTCCTGG + Intergenic
1042808385 8:72797037-72797059 TTGAGCATCATGACCTCTCCAGG + Intronic
1048122648 8:131599118-131599140 GTAAGCATGCTGAAATGTCCTGG - Intergenic
1048474204 8:134728557-134728579 GTGAGCATGCTGGGCTCAGCGGG + Intergenic
1049124081 8:140770395-140770417 GTGATCCTGCTGACCTCTGTGGG + Intronic
1062038104 9:134391651-134391673 GGCAGAATGCTCACCTCTCCAGG - Intronic
1203761528 EBV:14833-14855 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203762457 EBV:17905-17927 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203763386 EBV:20977-20999 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203764315 EBV:24049-24071 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203765244 EBV:27121-27143 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203766173 EBV:30193-30215 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1203767102 EBV:33265-33287 GTAAGTAACCTGACCTCTCCAGG + Intergenic
1186072848 X:5841521-5841543 GTGAGCATGCATACAACTCCAGG + Intronic
1187033234 X:15510105-15510127 CTTAGCATGGTCACCTCTCCAGG - Intronic
1187670063 X:21658257-21658279 GCGAGGACTCTGACCTCTCCGGG + Exonic
1189870786 X:45381082-45381104 ATGAGCTTGCTCAGCTCTCCTGG + Intergenic
1191726967 X:64291905-64291927 GTGATCAGGCTGACCTTCCCTGG - Intronic
1192147501 X:68691476-68691498 CTGAACAGGCTGAGCTCTCCTGG + Intronic
1194493944 X:94586657-94586679 CTGAGCATGCAGTGCTCTCCTGG - Intergenic
1196760223 X:119194118-119194140 GTCAACATGCAAACCTCTCCAGG + Intergenic
1199560948 X:149161812-149161834 GTCAGTCTGCTGGCCTCTCCTGG + Intergenic
1200266662 X:154649791-154649813 TGGGGCATGGTGACCTCTCCCGG + Intergenic