ID: 1142145739

View in Genome Browser
Species Human (GRCh38)
Location 16:88492293-88492315
Sequence CCCCACCCAATCCCAAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142145727_1142145739 20 Left 1142145727 16:88492250-88492272 CCCAATTTCTGTTTTATGGTCTC 0: 1
1: 0
2: 2
3: 22
4: 346
Right 1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1142145728_1142145739 19 Left 1142145728 16:88492251-88492273 CCAATTTCTGTTTTATGGTCTCT 0: 1
1: 0
2: 0
3: 44
4: 459
Right 1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1142145724_1142145739 30 Left 1142145724 16:88492240-88492262 CCCTTTCTCTCCCAATTTCTGTT 0: 1
1: 0
2: 11
3: 103
4: 933
Right 1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1142145725_1142145739 29 Left 1142145725 16:88492241-88492263 CCTTTCTCTCCCAATTTCTGTTT 0: 1
1: 0
2: 11
3: 100
4: 1028
Right 1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1142145731_1142145739 -7 Left 1142145731 16:88492277-88492299 CCACAGCTGCTCCCCACCCCACC 0: 1
1: 1
2: 19
3: 214
4: 1942
Right 1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1142145730_1142145739 -6 Left 1142145730 16:88492276-88492298 CCCACAGCTGCTCCCCACCCCAC 0: 1
1: 0
2: 10
3: 121
4: 918
Right 1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142145739 Original CRISPR CCCCACCCAATCCCAAGGGT GGG Intronic
902409164 1:16202628-16202650 ACCCACCTGATCCCGAGGGTGGG - Intronic
902650917 1:17837089-17837111 CCCCCACCAACCCCAAGGATGGG + Intergenic
902875835 1:19340175-19340197 TCTTACCCACTCCCAAGGGTGGG - Intronic
903269094 1:22176722-22176744 CCCCACCCACACACAAGGCTGGG - Intergenic
903964451 1:27078216-27078238 TCCCACCCACACTCAAGGGTGGG - Intergenic
905448245 1:38041350-38041372 CCACAGCCAATCCCAGAGGTAGG - Intergenic
905452930 1:38068571-38068593 CCCCATCCAAGCCCACGGGAAGG + Intergenic
906076572 1:43056378-43056400 CTCCCCCCACTCCCAACGGTGGG + Intergenic
907166997 1:52421620-52421642 CCCCACCAGATACCAAGGGGAGG - Intronic
908817278 1:68047293-68047315 CCCCTCCGAATCCCAACGATGGG - Exonic
913450067 1:118987270-118987292 CCCCTCCCAATCCCAGGGACCGG + Intronic
914981107 1:152415146-152415168 CCCCACCCCATGCTATGGGTAGG + Intergenic
915545406 1:156594200-156594222 TGGCACCCAATCCCCAGGGTTGG - Exonic
921355592 1:214281531-214281553 CCCCACCCCGCCCCAAGGGCCGG - Intronic
922805329 1:228383782-228383804 CCACACCCAATCTCCAGGGAAGG - Intergenic
923000600 1:230003829-230003851 CCCCACCCAAGCCCCAGAGCTGG + Intergenic
923052247 1:230396828-230396850 CCGCACACAATCCCATGGGGAGG - Intronic
923133143 1:231094895-231094917 TTCCTCCAAATCCCAAGGGTGGG - Intergenic
1064944237 10:20770497-20770519 GCCCACTCATTGCCAAGGGTTGG + Intergenic
1067510926 10:46894431-46894453 CCCCACCCAAATCAATGGGTTGG - Intergenic
1067651325 10:48157431-48157453 CCCCACCCAAATCAATGGGTTGG + Intronic
1068028896 10:51683546-51683568 CCCTACCCAAACCCCAGGGCAGG - Intronic
1069460757 10:68592738-68592760 TCCCACTGAAACCCAAGGGTTGG - Intronic
1069621913 10:69842583-69842605 CCCCACCCAAACGCAGGGGCTGG + Intronic
1070289697 10:75106053-75106075 TCGGACCCTATCCCAAGGGTAGG - Intronic
1071978482 10:90978877-90978899 TCCCAGTGAATCCCAAGGGTTGG - Intergenic
1075946777 10:126440219-126440241 TCCCACGCAATCCAAAGGGCTGG - Intronic
1075987763 10:126802814-126802836 CCCCACCAGATCCCCATGGTTGG + Intergenic
1077524981 11:3058722-3058744 CCCCAACTAATCCCAAAGGAGGG + Intergenic
1078266121 11:9757473-9757495 CCCCACCCAACCCTAAGGCTGGG + Intergenic
1081227438 11:40541537-40541559 TCCCACCCAGTCCCAAGGCAAGG - Intronic
1083180346 11:60981351-60981373 CCCTACCCAATTCCAGGGCTGGG - Intronic
1084489607 11:69471225-69471247 CCCCACTCAAACCCCAGGGTAGG + Intergenic
1084649353 11:70479584-70479606 CCCCACCCACTGCAAAGGGCTGG + Intronic
1085256457 11:75176280-75176302 CCTGACCCAGTCCCAAGGGCAGG - Intronic
1088179447 11:107092567-107092589 TCCCACGCAATCCAAAGGGCAGG - Intergenic
1089112188 11:116065543-116065565 TCCCTCCCAATCCCAGGGGTAGG - Intergenic
1091019721 11:132088225-132088247 CCCCACTCACTCTCAGGGGTCGG - Intronic
1091548008 12:1517330-1517352 CCCCACCAAATCCCAGGGTGGGG - Intergenic
1091645410 12:2268966-2268988 CCCCACCCCCTGCCCAGGGTCGG + Intronic
1094268960 12:28590216-28590238 CCCCACCCCATCCTAAAAGTGGG + Intergenic
1096118297 12:49069341-49069363 CCCCACCCCATCCCACTCGTAGG + Intronic
1096199898 12:49674003-49674025 CCCCAGCCAGTCACAAGGCTGGG - Intronic
1096631127 12:52927372-52927394 CCCCACCCTTTCCCCAGGGGAGG - Intronic
1103573316 12:121858920-121858942 CCCCACCCCATCCCCCAGGTAGG - Intronic
1103761137 12:123251148-123251170 TCCCACACAAACCCAAGGGCCGG + Intronic
1104309634 12:127642918-127642940 CCTCCCCCCATCCCAAGGGATGG + Intergenic
1105303068 13:19152303-19152325 CACCTCCCAAGCCCAAGGGTGGG + Intergenic
1105783112 13:23721453-23721475 CCCCACCCAATCCCACGTGTCGG - Intergenic
1108783611 13:53867731-53867753 TCCCACCCAAACCCAAGGAAAGG - Intergenic
1110082402 13:71331947-71331969 CCCCACCCAACCCCATGACTGGG - Intergenic
1110852650 13:80262810-80262832 TCCCACACAAACCAAAGGGTTGG + Intergenic
1112955805 13:105056731-105056753 ATCCACCCAATCCCCAGGGCTGG + Intergenic
1114958191 14:27849367-27849389 CCCCACCCAATGACTAGGGATGG - Intergenic
1115369559 14:32596818-32596840 CCCCACCTTTTCCCAAGGGAAGG - Intronic
1116819614 14:49615318-49615340 TCCCACCCAATCCCAAGGCACGG - Intergenic
1118748833 14:68792462-68792484 CCACTCCCAACCCCACGGGTGGG + Intronic
1119036048 14:71231288-71231310 CCCCACCAACTCGGAAGGGTTGG - Intergenic
1121239612 14:92419347-92419369 CTCCACCCAAACCCAAAGGAGGG - Intronic
1122266148 14:100547826-100547848 CCCGACCCAAACCCAAGCGAGGG + Intronic
1122626524 14:103087959-103087981 TCCCACCCAGTCCCCAGGGCAGG - Intergenic
1122635814 14:103129165-103129187 CACCTCCCAATCCCAGGGGTAGG - Intronic
1123010502 14:105347373-105347395 CCACACCCAATGCCCAGGGGTGG + Intronic
1124207118 15:27730526-27730548 CCCTCCCCATTCCCAAGGTTGGG + Intergenic
1130064026 15:80590138-80590160 CCCCACCCAACCCCCAGCCTGGG - Intronic
1132210319 15:100017178-100017200 TCCCACGCAATCCAAAGGGCTGG + Intronic
1132887677 16:2189709-2189731 CCGCCCCCAACCCCAAGGGTTGG - Intronic
1133166898 16:3954335-3954357 CCCCACCCAATCCCACCAATTGG - Intronic
1134058120 16:11182836-11182858 CCCCACCGCATGCCAAGGGTTGG + Intergenic
1134349562 16:13424089-13424111 CCCCACACAGTCCCAAGAGAGGG + Intergenic
1137722403 16:50635156-50635178 CCCCACTCAGGCCCAGGGGTGGG - Exonic
1138573170 16:57889019-57889041 CCCCACCCATCCTCAAGGGAAGG - Intronic
1138880987 16:61014732-61014754 TCCCACACAATCCTAAGGGCTGG - Intergenic
1139390819 16:66605410-66605432 CCTCACCCAGTCCCGGGGGTGGG - Intronic
1141391575 16:83668934-83668956 CTTCACCCATTCACAAGGGTAGG + Intronic
1142145739 16:88492293-88492315 CCCCACCCAATCCCAAGGGTGGG + Intronic
1145784894 17:27587417-27587439 CCCCCCTCAATCCCAAGTGCTGG - Intronic
1148875793 17:50686431-50686453 CCCCTCATTATCCCAAGGGTGGG + Intronic
1150351814 17:64451080-64451102 CCCCACCCACTCCCCAGTGGTGG + Intronic
1151532357 17:74714790-74714812 CCCCAGCAAGTCCCTAGGGTCGG + Intronic
1152069519 17:78127991-78128013 CCCCACCCAGTCCCTAGAGCTGG + Intronic
1152404189 17:80087179-80087201 CCCCAGCCAAGCTCAGGGGTAGG - Intronic
1154388227 18:13914478-13914500 CCCCACCCCATCCCCGGAGTGGG - Intronic
1155905622 18:31447709-31447731 CCCCACCCTAAACCAAGGGTAGG - Intergenic
1157169121 18:45385927-45385949 CCCCACCATGTCCCCAGGGTAGG + Intronic
1158829733 18:61263993-61264015 TCCCACACAATCCAAAGGGGTGG - Intergenic
1161975850 19:7607512-7607534 CCCAACCCAGGCCCCAGGGTGGG - Intronic
1165073761 19:33269698-33269720 CCACACCCCATCCCAAGGCCAGG - Intergenic
1168340544 19:55620876-55620898 TCCCCGCCAATCCCAAGGGCGGG - Exonic
926891845 2:17645304-17645326 CCCCACCCCCACCCAAAGGTTGG + Intronic
927884477 2:26710119-26710141 CCGCACCCTCTGCCAAGGGTGGG + Intronic
929529956 2:42743758-42743780 CACCACCCATTTCCCAGGGTTGG - Intronic
929805982 2:45145370-45145392 TCCCACACAATCTGAAGGGTTGG - Intergenic
935328217 2:101957270-101957292 CCCCACCCAGATTCAAGGGTGGG + Intergenic
936026163 2:109032578-109032600 CCCCACCCCACCCCATGGGGAGG - Intergenic
941900937 2:170677373-170677395 CCCCACCCCATCTGAAGAGTGGG + Intergenic
946389172 2:219405187-219405209 CCCCTCCCAGCCCCAAGGGCAGG + Intergenic
947625865 2:231618278-231618300 CCCCACCCACACCCAATGGGGGG - Intergenic
1169398569 20:5259442-5259464 CCCCACACAAGCCCCAGTGTGGG - Intergenic
1169951686 20:11051329-11051351 CCCCACTCACTCCCATGGGGTGG - Intergenic
1170426537 20:16240875-16240897 CCCAGCCCAAACCCAAAGGTCGG - Intergenic
1175800257 20:61797284-61797306 CACCATCCATTCCCCAGGGTGGG + Intronic
1178245233 21:30944322-30944344 GCCCACCCAAAGCCAAGGGTGGG - Intergenic
1179903126 21:44405422-44405444 CCCTCAACAATCCCAAGGGTAGG - Intronic
1182151188 22:28028260-28028282 CCCCACTCAGTCCCCAGGGCTGG + Intronic
1182277639 22:29200614-29200636 CCCCATCCCATGCCAAGGGTGGG - Intergenic
1182299226 22:29328660-29328682 ACCCACCCGATCCCTGGGGTAGG - Exonic
1182706233 22:32282282-32282304 CCCAACCCAAAACCCAGGGTCGG + Intergenic
1183741514 22:39671016-39671038 CCCCACCCTATCCCTGGGGTGGG - Intronic
1184347437 22:43922424-43922446 CTCCACCCAGTGCCAGGGGTAGG + Intergenic
1184394549 22:44225347-44225369 CCCAACCCAAAACCCAGGGTTGG + Intergenic
1184557143 22:45239758-45239780 CCCCACCCCACCCCCAGGCTAGG - Intronic
949938243 3:9134227-9134249 CCCCACCCAATTCCAATCTTTGG + Intronic
950469753 3:13177340-13177362 CCCCACCCCATCCCCATGCTGGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
955409653 3:58647371-58647393 CCTCAGCCAATCCCATAGGTGGG - Intronic
957448112 3:80340543-80340565 CCCCACCCACACCTAAGGGGTGG - Intergenic
960072422 3:113446229-113446251 CCCCACCCAAGCACAAGGACTGG + Intronic
960115215 3:113886043-113886065 CCCCACCCCAACCCAAGTGGAGG - Intronic
961983259 3:131104043-131104065 CCCCACCTACTCCCAAGCTTGGG - Intronic
962292413 3:134147608-134147630 CCCCTCCCACACCCAAGGGCTGG + Intronic
965813525 3:172614826-172614848 CCCCACCAATTCCAAAGGGGCGG + Intergenic
966576317 3:181506566-181506588 CCTCACCCAGACACAAGGGTGGG - Intergenic
966882988 3:184360436-184360458 TCCTACCCCATCCCAAGGGTTGG + Intronic
966992038 3:185242689-185242711 TCCCACACAATCCAAAGGGCTGG + Intronic
967180217 3:186896864-186896886 CCCCACCACATCCCAAGTCTGGG + Intergenic
967931604 3:194694234-194694256 CCACACCAGATACCAAGGGTGGG - Intergenic
967981834 3:195070397-195070419 CCCCACACAACCCCAGGGGATGG + Intronic
969347741 4:6579854-6579876 CCCCAGCCAATCCTAATGGCGGG + Intronic
970127942 4:12835422-12835444 ATTCACCCAATCCTAAGGGTGGG + Intergenic
972281182 4:37603427-37603449 CCCCACCCAGACTAAAGGGTCGG + Intronic
972670200 4:41207778-41207800 CTCAACTCAATCCCAAGGGCAGG + Intronic
975168581 4:71206842-71206864 CCCAAACCAATCACTAGGGTCGG - Intronic
977721409 4:100244167-100244189 CCCCACCCAACCCCCAGAGAGGG + Intergenic
982098192 4:151942533-151942555 CCCCACACACTCTCAAGGGGAGG - Intergenic
982630531 4:157824282-157824304 TCCCACGCAATCCGAAGGGCAGG - Intergenic
985092867 4:186381799-186381821 TCCCACCCAAACCAAAGGGCCGG - Intergenic
985217788 4:187672048-187672070 TCCCACCCAAACCAAAGGGCCGG + Intergenic
987577698 5:19752357-19752379 TCCCACACAATCCAAAGGGCTGG - Intronic
990572754 5:57095265-57095287 TCCCACGCAATCCAAAGGGCTGG - Intergenic
996308611 5:122078118-122078140 CACCAAGCAATGCCAAGGGTGGG + Exonic
1003030483 6:2596716-2596738 CCCCAGCCACTGCAAAGGGTGGG - Intergenic
1003711942 6:8602508-8602530 TCCCACACAATCCAAAGGGCTGG + Intergenic
1004168871 6:13280311-13280333 CCCCAGCCAGTCCCAGGGGAGGG - Intronic
1004317901 6:14606673-14606695 CCCCACCCACACTCAAGGGAAGG + Intergenic
1005281273 6:24277245-24277267 CCCCTCACAGTCCCACGGGTGGG + Intronic
1005332255 6:24761457-24761479 CCCCACCAACTCGGAAGGGTCGG + Intergenic
1005888049 6:30112264-30112286 GCCCACTCAAGCCCAAGGGGTGG + Intronic
1005990623 6:30899579-30899601 CCCCACCCTTCCCCAAGGGATGG - Intronic
1007594902 6:43045435-43045457 CCCCAGCCCATCCCAAGGTGTGG - Intronic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1013287526 6:108693910-108693932 ACCCACACTGTCCCAAGGGTGGG + Intergenic
1014913188 6:127118125-127118147 CCCCACCCCATCCCCAGCGCCGG - Intergenic
1015605729 6:134953050-134953072 CCCCACCACATCCCAAGGGGTGG + Intergenic
1016207941 6:141492334-141492356 TCCAACCTAATCTCAAGGGTAGG + Intergenic
1018425729 6:163678897-163678919 TCCCACCCAAACCCAAGAGGAGG - Intergenic
1018778688 6:167043266-167043288 CCCCACCCAATGCCACAGGAGGG - Exonic
1019427755 7:985338-985360 CTCCACCCCACCCCAAGGATGGG - Intronic
1019636006 7:2076070-2076092 CCTCATACCATCCCAAGGGTCGG - Intronic
1020278479 7:6638023-6638045 CCCCATCCAATCCCAGGGATGGG - Intronic
1020613266 7:10427188-10427210 CCCCCCCCAATCCCACTGATGGG - Intergenic
1022401280 7:30040585-30040607 CCCCACCCAAACCTCATGGTTGG + Intronic
1023215266 7:37855513-37855535 CCCCACCAAATCCCAAGTTAGGG + Intronic
1024000979 7:45189293-45189315 CCCCACCTCACCCCATGGGTGGG + Intergenic
1024020271 7:45362164-45362186 CCCCTCCCCATCCCCAGGCTTGG + Intergenic
1024093674 7:45967959-45967981 GCCTGCCCATTCCCAAGGGTTGG + Intergenic
1027417670 7:77990364-77990386 TCCCACGCAATCCAAAGGGCTGG + Intergenic
1028621703 7:92834518-92834540 CCCCACGGGATCCCAAGGGTGGG + Intronic
1028793036 7:94875352-94875374 CCCCTCCCCACCCCAAGGATGGG + Intergenic
1029375349 7:100174087-100174109 CCCCACCCTACACCTAGGGTTGG + Intronic
1032091194 7:128912476-128912498 CCCCACCGCACCCCAGGGGTTGG - Intergenic
1032115210 7:129111033-129111055 CCTCACCCAACCCCAACTGTAGG - Intergenic
1032582072 7:133112739-133112761 CCCCACCCTACCCCAAGGTAGGG + Intergenic
1032599484 7:133278407-133278429 CCCCACCCACTCACCAGGGAGGG + Intronic
1035189516 7:157153550-157153572 CCCCAGGTAATCCCAAGTGTTGG + Intronic
1035581663 8:744230-744252 CCCAACCCAATCTCGTGGGTCGG - Intergenic
1036791571 8:11724801-11724823 ACCCACTCACTCCCAAGGCTGGG - Intronic
1039083317 8:33755485-33755507 TCCCACACAAACCAAAGGGTTGG + Intergenic
1039400538 8:37265450-37265472 CCCTGCCCAAACCCAAGGGGAGG - Intergenic
1039572546 8:38599384-38599406 CCCCACCAGATCCCAAGGCCAGG + Intergenic
1041107577 8:54458061-54458083 CCCCACCCCCTCCCCCGGGTCGG + Exonic
1042467157 8:69140969-69140991 TCCCACACAAACCGAAGGGTCGG + Intergenic
1044015923 8:87048783-87048805 CCCCACCAAATTCAAAGGATAGG - Intronic
1045311192 8:101004741-101004763 CCCAACCCCATCACCAGGGTAGG - Intergenic
1049249619 8:141581172-141581194 CCCCACCCTCTCTCAAGGGGTGG - Intergenic
1053341691 9:37341525-37341547 CCCAACCCCATCCCCAGGCTAGG - Intronic
1054903497 9:70393554-70393576 CCCCACCCAAGTCCAGGGATGGG + Intronic
1056767711 9:89455028-89455050 CCCCACCCCCTCCCAACTGTTGG - Intronic
1056772646 9:89491207-89491229 TCCCACCCACTCCCAAGTGTGGG + Intronic
1057631870 9:96725823-96725845 CACCACCCCATCCCCAGGGATGG + Intergenic
1058653150 9:107195708-107195730 CCCCCCCCACCCCCGAGGGTTGG - Intergenic
1059764474 9:117370902-117370924 CCCCCAACAATCCCAAGGGAGGG + Intronic
1060722752 9:125989524-125989546 CCCCTCCCAATCCTGAGGGGCGG - Intergenic
1060815604 9:126633519-126633541 CCCCAGCCAGTCCCCAGGATTGG - Intronic
1191714127 X:64182527-64182549 CCCCACCCAACCCCCAGCCTTGG - Intergenic
1194701518 X:97119856-97119878 TCCCACGCAATCCAAAGGGCTGG + Intronic
1196723292 X:118874888-118874910 CCCCACCCAATCATCTGGGTTGG + Intergenic
1196948296 X:120850403-120850425 TCCCACACAATCCGAAGGGCTGG + Intergenic
1197664629 X:129210555-129210577 TCCCACACAATCCAAAGGGCTGG + Intergenic
1198444393 X:136697027-136697049 CCTCACCCCAGCCCAAGTGTAGG + Intronic
1200309663 X:155065300-155065322 CTCCCCCCAGGCCCAAGGGTGGG + Exonic
1200321751 X:155196803-155196825 CCCCACCCAATGAGGAGGGTTGG + Intergenic
1200389437 X:155929447-155929469 CCCCACACAATGCCCAGGGGGGG - Intronic