ID: 1142148314

View in Genome Browser
Species Human (GRCh38)
Location 16:88501843-88501865
Sequence TGGCAAACAGCAGTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 1, 2: 5, 3: 72, 4: 380}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142148314_1142148321 2 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148321 16:88501868-88501890 GGATCAACCCCAGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1142148314_1142148320 1 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148320 16:88501867-88501889 GGGATCAACCCCAGCCCGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 60
1142148314_1142148328 12 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148328 16:88501878-88501900 CAGCCCGCGAGGGGGCTCCTGGG No data
1142148314_1142148327 11 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148327 16:88501877-88501899 CCAGCCCGCGAGGGGGCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 204
1142148314_1142148332 30 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148332 16:88501896-88501918 CTGGGCCGATGAGCAAACTGAGG 0: 1
1: 0
2: 0
3: 47
4: 490
1142148314_1142148322 3 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148322 16:88501869-88501891 GATCAACCCCAGCCCGCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 42
1142148314_1142148323 4 Left 1142148314 16:88501843-88501865 CCTCCTGCCACTGCTGTTTGCCA 0: 1
1: 1
2: 5
3: 72
4: 380
Right 1142148323 16:88501870-88501892 ATCAACCCCAGCCCGCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142148314 Original CRISPR TGGCAAACAGCAGTGGCAGG AGG (reversed) Intronic
900461573 1:2804519-2804541 TGGCAGCCCCCAGTGGCAGGAGG - Intergenic
901177933 1:7318229-7318251 AGGCACTGAGCAGTGGCAGGTGG + Intronic
903180816 1:21603914-21603936 TGGCAAGCAGCAGAGGGCGGGGG + Intronic
905344038 1:37299341-37299363 TAGCAGACAGCACTGCCAGGAGG + Intergenic
905611807 1:39359131-39359153 GGACAAGCAGCAGTTGCAGGAGG + Exonic
905856815 1:41319942-41319964 TGGGGAACAGCAGTGCCTGGAGG - Intergenic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
906506440 1:46383232-46383254 TGGGAAAGAGGAGGGGCAGGGGG + Intergenic
906605140 1:47164049-47164071 TGGCAGCCAGCAGTGGCTGGAGG - Intergenic
907316290 1:53574797-53574819 TGGTAAAAAGCTGGGGCAGGAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910388954 1:86717342-86717364 TGGCACAAAACAGGGGCAGGAGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912134567 1:106644704-106644726 TGGGAAACAGAAGTTGCAGTGGG - Intergenic
913939545 1:125087807-125087829 GGGCAAACAGCCGCGGCAGCGGG + Intergenic
914133826 1:144882794-144882816 GGGCAAAAAGCTGTGGCAGCGGG + Intergenic
916375591 1:164149931-164149953 TTTCAAAAAGCAATGGCAGGAGG + Intergenic
916547368 1:165818210-165818232 TGACAAACTGCAGAGGAAGGTGG + Intronic
917242635 1:172965538-172965560 TGGCAAACAGCATTCTCTGGAGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917835471 1:178938477-178938499 TGGCAGACAGAGGAGGCAGGAGG + Intergenic
918667393 1:187168527-187168549 GAGTAAACAGCACTGGCAGGTGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920296358 1:204959523-204959545 GGACTAACAGCATTGGCAGGGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920703690 1:208236400-208236422 GGGCAGACAGAAGTGGCAAGAGG - Intronic
920846586 1:209598410-209598432 TGGCACACTGGAGTGGCAGCTGG - Intronic
921593024 1:217025594-217025616 TGGCAAACAGCTTTGGCAGGTGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923286127 1:232497600-232497622 TAGCAGACAGCTCTGGCAGGAGG - Intronic
923666674 1:236004332-236004354 TGGCAGACAGCAGAGGAAAGGGG + Intronic
924207125 1:241725021-241725043 AGGCAGACAGCAGGGGCAGGGGG + Intronic
1064060268 10:12130873-12130895 TGTCAAACATCAGTGACTGGTGG + Intronic
1065593302 10:27287521-27287543 TGGCATCCGGCAGTGGGAGGTGG + Intergenic
1066780543 10:38941844-38941866 TGGCAAAAAGCAGCGGCGGCAGG - Intergenic
1067434711 10:46268838-46268860 TAGATAACAGCAATGGCAGGCGG - Intergenic
1067960433 10:50842107-50842129 TGCCAAATAGTACTGGCAGGAGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069753200 10:70757982-70758004 GGGCATCCAGCAGCGGCAGGTGG + Exonic
1070498758 10:77050454-77050476 TTGCTAACAGCAGTGGCTGGTGG - Intronic
1070988369 10:80708446-80708468 TGGTAAACAGTATTGGCTGGTGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071884032 10:89930299-89930321 TGACAAACAGTAATGGCATGGGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073993610 10:109291828-109291850 TGGAAACCAGCAGTGGCAACCGG + Intergenic
1075392107 10:122099654-122099676 TGGCTGACAGCATTTGCAGGAGG - Intronic
1075705028 10:124495368-124495390 TGCCTAACAGGAGTGGCAGGGGG + Intronic
1076231203 10:128821324-128821346 TGGGAAACAGCAGGATCAGGCGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077876928 11:6317039-6317061 TGGAAAACAGGAATGGCAAGGGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080874674 11:36264910-36264932 TAGCAAAAGGCAGTGGCTGGTGG + Intergenic
1082180845 11:49117327-49117349 TGGCAAACATTACTGGGAGGTGG - Intergenic
1083327497 11:61880205-61880227 CGGCAACCAGCAGAGACAGGCGG + Intronic
1083391989 11:62358546-62358568 TGTAAAGCAGCAGTGGCTGGTGG - Intronic
1084212922 11:67632127-67632149 GGGCAAAGAGCACAGGCAGGGGG - Intronic
1084476197 11:69391048-69391070 AGGCAGACAGGAGTGGAAGGTGG + Intergenic
1084476217 11:69391153-69391175 AGGCAGACAGGAGTGGAAGGTGG + Intergenic
1084837067 11:71810182-71810204 TGGCAAAGAAGAGTGGCAGTAGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085199995 11:74696185-74696207 TGTCAAAGAGCTGTGGGAGGGGG + Intergenic
1085388235 11:76169276-76169298 GGCCACACATCAGTGGCAGGTGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085885296 11:80514495-80514517 TAGCAAAAAGCATGGGCAGGTGG + Intergenic
1086684651 11:89717533-89717555 TGGCAAACATTACTGGGAGGTGG + Exonic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089402820 11:118174406-118174428 TGGCAAAGAGAAAGGGCAGGTGG - Intronic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091673831 12:2473119-2473141 GGGGAAAAAGCAGTGTCAGGAGG - Intronic
1091794097 12:3287515-3287537 TGGGACACAGCAGCTGCAGGAGG - Intergenic
1092402163 12:8185922-8185944 TGGCAAAGAAGAGTGGCAGTAGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093254041 12:16843550-16843572 TTTCACACAGCGGTGGCAGGGGG - Intergenic
1093257030 12:16881275-16881297 TGGCAGGCTGCAGTCGCAGGTGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094793344 12:33940183-33940205 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095039150 12:37423071-37423093 AGACATACAGCAGTGGCAGAGGG + Intergenic
1095104619 12:38216935-38216957 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095474000 12:42566405-42566427 TGGCAAACAGAAATTGGAGGGGG + Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097658250 12:62396211-62396233 TGTCAAACAACAATGGCAGAAGG + Intronic
1097983518 12:65758556-65758578 TTGCATAAAGCAATGGCAGGTGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1101147802 12:101857767-101857789 TGGGAAACATCAGTGGAAAGGGG - Intergenic
1103780688 12:123396835-123396857 TGTTAAACAGCAGTGGCTTGGGG + Intronic
1104714351 12:131006547-131006569 TGGAGGACAGCAGAGGCAGGGGG - Intronic
1104727248 12:131085582-131085604 TGGAAACCAGGAGTGGAAGGAGG + Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107419005 13:40228680-40228702 TAAGAAACAGCACTGGCAGGAGG - Intergenic
1107673414 13:42770157-42770179 TGGAAAACACCTGTGGCAGAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110545663 13:76752452-76752474 TTGAAAACAGAAGTGGTAGGGGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111531236 13:89540929-89540951 TGGAATACAGAAGTGGCACGTGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111855146 13:93627527-93627549 TGTGAAGCAGCAGTGGAAGGAGG - Intronic
1112719874 13:102231375-102231397 TTGTGAACAGCAGTGACAGGAGG + Intronic
1113838679 13:113346545-113346567 TGGCAAAGAGCAGACCCAGGAGG + Intronic
1114350532 14:21845509-21845531 AAGCAAACAGCAGTGCCATGTGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115364679 14:32544534-32544556 TCGCAAACACCAGTGGGAGCAGG + Intronic
1116167448 14:41351309-41351331 AGGCAAAGAGTAGGGGCAGGAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117329526 14:54698611-54698633 TGGCTCTCAGCAGTGGCAGCTGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120373992 14:83676835-83676857 TGGTAAACAGCAGTCACAGTTGG - Intergenic
1121106757 14:91285309-91285331 TGTCAAGCAGCACTGGCGGGTGG - Intronic
1122118340 14:99538593-99538615 TGGGAACCAGCAGGGGGAGGCGG - Intronic
1122819632 14:104334996-104335018 GGGCAAACTCCTGTGGCAGGAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124379835 15:29156025-29156047 TGGCAAACAGCAGGCACAGGTGG + Intronic
1125210190 15:37205882-37205904 TGAAAAACAGCAGAGGCAAGAGG + Intergenic
1126481189 15:49121979-49122001 TTTCACACAGCAGTGGTAGGTGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128108098 15:65058957-65058979 TGGCATCCAGCCTTGGCAGGGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128472613 15:67967960-67967982 GGGCAAACAGCCGTGAGAGGGGG - Intergenic
1128494225 15:68183122-68183144 TGACAGACTGCAGTGGCATGAGG - Intronic
1129166817 15:73783174-73783196 TGGAATATAGCAGTGCCAGGAGG - Intergenic
1129691177 15:77714475-77714497 TGGCAAAGGGCAGTGGCAGGGGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129990343 15:79956576-79956598 AGGCAAACATCTGTGGCAGAAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132030985 15:98438397-98438419 TGGCAAGGAGCAGAGGCAGCAGG + Exonic
1133056509 16:3148018-3148040 TGGCAAACAGAGGATGCAGGTGG - Intronic
1134135513 16:11674146-11674168 AGGCAGACAGCACTGGAAGGAGG - Intronic
1136110932 16:28063355-28063377 TGGCGAACAGCAGCGCCAGCAGG + Exonic
1136797080 16:33029029-33029051 GGGCAAAAAGCTGTGGCAGCAGG + Intergenic
1136938763 16:34500523-34500545 AGGCAAAAAGCCGTGGCAGCAGG + Intergenic
1136961056 16:34848033-34848055 AGGCAAAAAGCCGTGGCAGCAGG - Intergenic
1136994809 16:35182257-35182279 TGGCCTCCAGCAGTGGCAGGTGG - Intergenic
1137218787 16:46427231-46427253 GGGCAAAAAGCAGCGGGAGGGGG + Intergenic
1137750215 16:50855921-50855943 TGGCAAGCAGAACTGGCAGATGG - Intergenic
1138638587 16:58364260-58364282 TGCACATCAGCAGTGGCAGGTGG + Intronic
1140213323 16:72987791-72987813 TGGCAACCAGGAATGGCCGGAGG + Intronic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142577874 17:921412-921434 TGGAAAGCAGCAGTTTCAGGGGG - Intronic
1142690803 17:1605295-1605317 GGGAAAACAGCAGCTGCAGGCGG + Intronic
1144859538 17:18292229-18292251 TGGGAAACTGCAGTGACAGGGGG + Intronic
1145203557 17:20968409-20968431 TTGCTAACATCAGGGGCAGGGGG - Intergenic
1145693384 17:26766813-26766835 GGGCAAAAAGCCGTGGCAGCGGG - Intergenic
1145693392 17:26766837-26766859 GGGCAAAAAGCCGTGGCAGCGGG - Intergenic
1147368099 17:39972767-39972789 TGGGAAAAAGCAGTGGAAAGGGG + Intronic
1147653960 17:42077992-42078014 TGGAGCCCAGCAGTGGCAGGAGG - Intergenic
1148520134 17:48265801-48265823 AGGCAAACTCCTGTGGCAGGTGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1151093825 17:71473243-71473265 AGGCACACATCAGAGGCAGGAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151602053 17:75112030-75112052 TGAGAGACAGCAGTGGAAGGTGG + Intronic
1152497407 17:80683314-80683336 GGGCAAGCATCTGTGGCAGGAGG + Intronic
1152534072 17:80940554-80940576 TGCGAAACAGCCGTGTCAGGAGG + Exonic
1152788892 17:82267471-82267493 TGGAACGCAGCAGTGGCAAGGGG - Intronic
1203191928 17_KI270729v1_random:198897-198919 GGGCAAAAAGCAGGGGCAGCGGG - Intergenic
1153315340 18:3715867-3715889 TTGCAAACCACAGTTGCAGGTGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153625659 18:7020253-7020275 TGCCCCACAGCAGAGGCAGGAGG + Intronic
1156610798 18:38721806-38721828 GGGGAAAAAGCAGTGTCAGGAGG - Intergenic
1156869135 18:41924743-41924765 AGGAGAACAGCAGTGGCAGTAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160187583 18:76687596-76687618 AGGCACACAGAAGGGGCAGGGGG + Intergenic
1160869739 19:1271730-1271752 GGGCAAGGAGCAGAGGCAGGTGG + Intronic
1161512064 19:4677388-4677410 TGGCCGGCAGCAGGGGCAGGTGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1165956925 19:39506970-39506992 TGGGAAACAGCGCGGGCAGGTGG + Intronic
1166067411 19:40367899-40367921 TGGCCGGCAGCAGGGGCAGGGGG + Intronic
1166442914 19:42831610-42831632 AGGCCAACAGCAGTGGAAAGTGG + Intronic
1166942440 19:46375036-46375058 CGGCATGCAGCAGGGGCAGGTGG - Intronic
1167202759 19:48077826-48077848 TGCAAAAGAGCAGAGGCAGGGGG + Intronic
1167671800 19:50857847-50857869 TGGGAAACAGCAGTGTGAGAGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168345184 19:55647232-55647254 TGGTGAACAGGAGAGGCAGGTGG + Intronic
1168588675 19:57614945-57614967 TGGGCCAGAGCAGTGGCAGGAGG + Intronic
1202683807 1_KI270712v1_random:31190-31212 GGGCAAAAAGCTGTGGCAGCGGG - Intergenic
925189937 2:1874689-1874711 TGGCAAACGGCACGGGCAGAGGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928322973 2:30297849-30297871 TGGGAAGCTGCAGTGGGAGGTGG + Intronic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930680811 2:54255359-54255381 TGGCAGACAGCTGTGGGTGGTGG + Exonic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932475780 2:72004949-72004971 TGGGAACCAGGACTGGCAGGGGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934247866 2:90323568-90323590 GGGCAAAAAGCCGTGGCAGCGGG + Intergenic
934331417 2:92073283-92073305 GGGCAAAAAGCAGTGGGAGCGGG - Intergenic
937127848 2:119485565-119485587 TGTCAGGCTGCAGTGGCAGGGGG + Intronic
937325602 2:120988217-120988239 TGGAAAACTTCAGTGGCAGTGGG + Exonic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940823622 2:158385719-158385741 TGACCTACAGCAGTGTCAGGAGG - Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943345695 2:186734761-186734783 TGGGAAACAGCAGAGGCTGAGGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945386574 2:209209145-209209167 TGGGAAACAGGTGTTGCAGGGGG + Intergenic
947371910 2:229455655-229455677 GGGCAGACAGCCGTGGCAAGAGG + Intronic
947940564 2:234051124-234051146 AGGCAGACAGCATTGGAAGGAGG - Intronic
948177816 2:235957984-235958006 TGGAAGTCAGCAGGGGCAGGGGG + Intronic
1169379799 20:5096564-5096586 TACCATACACCAGTGGCAGGAGG + Intronic
1170136492 20:13079893-13079915 GGGCAAACAGCTGTGGCAGGTGG - Intronic
1171094817 20:22321727-22321749 TGGTAAAAAGCAGGGGAAGGAGG - Intergenic
1171135353 20:22690200-22690222 TGGAAAACAGCGTTTGCAGGGGG + Intergenic
1171225688 20:23440291-23440313 GGGCAATCAGCAGCAGCAGGGGG - Exonic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172385448 20:34530927-34530949 TGTCAAAAGGCAGTGGCAGATGG - Intronic
1172829560 20:37821833-37821855 TGGCATCCAGCTGTGGCAAGAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173478795 20:43383085-43383107 AGCCAAACAGCTGTGGCTGGAGG - Intergenic
1175964925 20:62655662-62655684 TGGCTAACAGGAGTTGCAGTCGG - Intronic
1176307297 21:5130438-5130460 TGGCAGACAGCACTGGCAGTCGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177856133 21:26402620-26402642 TGGCAAAAAGCAATAGCAGATGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179118981 21:38525265-38525287 TGCCAAAAAGAGGTGGCAGGAGG - Intronic
1179172153 21:38981099-38981121 AGCCAAACCACAGTGGCAGGTGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179849762 21:44131592-44131614 TGGCAGACAGCACTGGCAGTCGG - Intergenic
1180057677 21:45367293-45367315 TGGCAGCCAGCAGTGGGAGAGGG - Intergenic
1180281274 22:10698972-10698994 GGGCAAAAAGCCGTGGCAGCGGG - Intergenic
1180921816 22:19525077-19525099 TGGCAAAAAGCGGTGGCACAGGG + Intronic
1181058894 22:20272661-20272683 TGGCAAACACAAGTGGCCCGAGG - Intronic
1182454883 22:30443959-30443981 TGGGGTACAGCAGTGGTAGGTGG - Intergenic
1183118773 22:35713444-35713466 TGGGAAACACCAATGGTAGGTGG - Intergenic
1183705537 22:39473058-39473080 TGTGAAATAGCAGTGGGAGGCGG + Intronic
1183845013 22:40535797-40535819 TGGCGAACAGTTTTGGCAGGAGG - Intronic
1185372259 22:50466360-50466382 GAGGAAACAGCAGTGCCAGGAGG + Exonic
1203238358 22_KI270732v1_random:30434-30456 GGGCAAAAAGCCGTGGCAGCGGG - Intergenic
950060210 3:10064801-10064823 GAGAAAACAGCAGCGGCAGGAGG - Exonic
950301577 3:11884024-11884046 GAGAAAACAGCAGCGGCAGGAGG - Intergenic
950708731 3:14800356-14800378 GGGCAAACAAGAGTGGTAGGAGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951522693 3:23624273-23624295 TGGCAAACAGCATGGGCACAGGG - Intergenic
952862084 3:37821415-37821437 TGGCAAAATGCAGTGGCATGTGG + Exonic
953222955 3:40989896-40989918 TCCAAAACAGCAGAGGCAGGAGG - Intergenic
953326969 3:42020088-42020110 TGGAGAACAGCAGTGGGAAGAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955744946 3:62131234-62131256 TGTCACATAGCAGTGGGAGGGGG - Intronic
955758252 3:62249299-62249321 GGGCAGACAGGAGGGGCAGGGGG + Intronic
957094062 3:75761483-75761505 TGGTGAATAGAAGTGGCAGGAGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960235975 3:115282632-115282654 TTGCCCACACCAGTGGCAGGAGG - Intergenic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961331016 3:126138015-126138037 TCGCTAGCAGCAGTGGCAGTGGG + Intronic
962154754 3:132934494-132934516 GTGCAAGCAGCAGTGGTAGGTGG - Intergenic
962716561 3:138131155-138131177 AGGCAAACAGAAGAGGCAGCTGG + Exonic
962927213 3:140005847-140005869 TGGCAAACAGCAATGGCAAAAGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
964072044 3:152646916-152646938 TGTCCAAGAGAAGTGGCAGGAGG - Intergenic
966736084 3:183188231-183188253 GGACCAACTGCAGTGGCAGGTGG + Intronic
966782927 3:183600699-183600721 TGGCAAACCCCAGAGGCTGGAGG + Intergenic
968960737 4:3742158-3742180 TTCCAACCAGCAGTGGCAGGTGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969320818 4:6411389-6411411 TGGCACACAGCAGGAGCAGCAGG + Intronic
969778476 4:9377678-9377700 TGGCAAAGAAGAGTGGCAGTGGG - Intergenic
969882092 4:10183091-10183113 TAGGATACAGCAGTGGCAGAGGG + Intergenic
971421102 4:26474879-26474901 TGACAATGAACAGTGGCAGGAGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977769849 4:100845388-100845410 TGGCAGACAGCAGTGAGAGATGG + Intronic
977838425 4:101672276-101672298 TGGCAAATGGCAGTGATAGGAGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979450603 4:120866091-120866113 TGGCAAACAGCATTGGTATGAGG - Intronic
979645303 4:123060606-123060628 ATGCACTCAGCAGTGGCAGGGGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980043885 4:127967585-127967607 TGGAAAAGAGCAGTGTCAGAGGG - Intronic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981449396 4:144878970-144878992 TGGCTAACAGCAGATGCACGTGG + Intergenic
982227004 4:153175475-153175497 TGGGAAACAGCGGGGGGAGGGGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983537512 4:168873956-168873978 AGGGGAACAGCAGTGGCAGGTGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984563550 4:181300024-181300046 TGGCAAGGAGCATGGGCAGGAGG - Intergenic
985493055 5:190310-190332 AGAGAAACAGCAGTGGGAGGGGG - Intergenic
985610648 5:886198-886220 GGGCAGCCAGCATTGGCAGGGGG - Intronic
986287404 5:6370127-6370149 TGACTAACAGTAATGGCAGGTGG + Intergenic
987088826 5:14492841-14492863 TGGCAGGCAGCAGAGGGAGGGGG + Intronic
987335541 5:16895271-16895293 TGGGACAAAGCAGTGGCAGGGGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987935125 5:24453673-24453695 TGTCAAACAAAAGTGGCAGGAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990476944 5:56170713-56170735 TGGCAGCATGCAGTGGCAGGCGG + Exonic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991956065 5:71997100-71997122 TGTCAAACAGGAATGGCATGGGG - Intergenic
992167331 5:74067538-74067560 TGGCAAAGGGAAGTGCCAGGTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992828355 5:80570568-80570590 TGGCCAACAACAGCGGCAGCAGG + Intergenic
992934026 5:81682626-81682648 TGCCAAAAAGCAGTGGTAAGAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994590001 5:101760520-101760542 TGGCAAGCAGTATTGGCAGGTGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995485962 5:112640454-112640476 TGCCAATGAGCAGTGACAGGGGG - Intergenic
995596960 5:113757600-113757622 TGTGAAACAACAGTGGCAGCTGG - Intergenic
995746250 5:115407051-115407073 TGGCAGACACCAGAAGCAGGAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
997603549 5:135156688-135156710 CGCCCAACAGAAGTGGCAGGTGG - Intronic
997694344 5:135849737-135849759 TGGGGAACAGCAGGGGCAGCTGG + Intronic
998785996 5:145709407-145709429 TGGGAGACAGCAGGAGCAGGGGG + Intronic
999019987 5:148154501-148154523 GGGGAAACTGCAGTGGCAGAAGG - Intergenic
999132493 5:149295103-149295125 TGGCAGGCAGCAGGGGCAGAGGG - Intronic
999195257 5:149777475-149777497 TGACAATCAGGAGTGGGAGGGGG + Intronic
999545268 5:152622478-152622500 GGGCAAAAAGCAATGGCATGTGG - Intergenic
1001447191 5:171794675-171794697 ATGCAATCAGCAGTGGCAGGAGG + Intergenic
1001555037 5:172631342-172631364 AAGCAAACAGGAGTGGCAGGGGG + Intergenic
1001656937 5:173358295-173358317 ATGAGAACAGCAGTGGCAGGTGG + Intergenic
1001803082 5:174560117-174560139 TGGGAAGCAGCAGTGGAAGCAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005358865 6:25011141-25011163 TGGCAATGAGCAGTGGAGGGAGG + Intronic
1005654426 6:27919524-27919546 AGGCAGACAGCAGTATCAGGAGG + Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006418714 6:33920338-33920360 TGGCAGAGTCCAGTGGCAGGTGG + Intergenic
1006610599 6:35292226-35292248 TGGTGAACAGCAGAGGCAAGAGG - Intronic
1007918451 6:45584637-45584659 AGGCCAAAAGCAGTGGCATGGGG + Intronic
1007966487 6:46008185-46008207 AAGCCAACAACAGTGGCAGGAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008831764 6:55772800-55772822 TGGCAAGCAACAGAAGCAGGAGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010399223 6:75429281-75429303 TGGCAAACAGAAATGCAAGGGGG + Intronic
1011183738 6:84651237-84651259 TGGCTAACAACAGTGGAAGCTGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014229787 6:118890384-118890406 TCACAAACAGGAATGGCAGGAGG - Intronic
1014436433 6:121425970-121425992 TTGCAAACAGCAGAGACAGTTGG - Intergenic
1015569295 6:134604724-134604746 AGGGACAGAGCAGTGGCAGGTGG - Intergenic
1015626919 6:135188831-135188853 TCCCAAACACCATTGGCAGGTGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018062713 6:160103183-160103205 TGGCAAATGACAGTGGCAGCAGG - Intronic
1018727038 6:166620941-166620963 TGGCACCGAGCAGGGGCAGGAGG + Intronic
1019224712 6:170500399-170500421 TCAGAAACAGCAGGGGCAGGGGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021880986 7:25095149-25095171 TGGCAAGAAGGAGTTGCAGGTGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023822212 7:43986560-43986582 GGTCAAACAGTAGGGGCAGGGGG - Intergenic
1023861401 7:44219573-44219595 TGGCAGACAGCAGAGCCTGGGGG - Intronic
1024306978 7:47937596-47937618 TGGCAGGCAGGAGTGGCAGCAGG + Intronic
1025878567 7:65509921-65509943 GGGCAAAAAGCAGTGGGAGCTGG + Intergenic
1027139705 7:75648474-75648496 GGGGCAACAGCAGTGTCAGGAGG - Intronic
1027139949 7:75649910-75649932 GGGGGAACAGCAGTGTCAGGAGG - Intronic
1027623891 7:80525088-80525110 TGACAAACGGCAGAGGAAGGTGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028142992 7:87291970-87291992 TGGCTACCAGCAGTGGCAGTGGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029480016 7:100806648-100806670 GGGGAAAAAGCAGAGGCAGGTGG - Intronic
1029750478 7:102539974-102539996 GGTCAAACAGTAGGGGCAGGGGG - Intronic
1029768430 7:102639082-102639104 GGTCAAACAGTAGGGGCAGGGGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032306870 7:130742192-130742214 TGGCAAACAAGAGTGGAAGCAGG + Intergenic
1033311746 7:140266764-140266786 GGGCGAACAGCAGTGGGAGGGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036206644 8:6810420-6810442 TGGAAAGCAGCAGTGGGAGCTGG + Exonic
1036275924 8:7351674-7351696 TGGCAAAGAAGAGTGGCAGTAGG - Intergenic
1036459733 8:8941242-8941264 AGGGAAGCAGCAGTGGCGGGCGG + Intergenic
1036638003 8:10564699-10564721 TGGCACACGGGAGAGGCAGGAGG + Intergenic
1036782582 8:11659680-11659702 TGGGCAGCAGCAGGGGCAGGCGG - Intergenic
1036927872 8:12924885-12924907 AGTCAGAGAGCAGTGGCAGGTGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039832022 8:41223058-41223080 TGACAAGCAGCAGAGCCAGGAGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043423363 8:80123203-80123225 GGGCCAAAAGCAGAGGCAGGAGG + Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1045196714 8:99939938-99939960 TGATAAACAGAAGTGGCAAGAGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046629316 8:116607771-116607793 GGGAAAACAGGAGTGGCAGTAGG - Intergenic
1048340918 8:133537763-133537785 TGGCAAGCAGCAGAGGCATCTGG + Intronic
1048434649 8:134404934-134404956 TGGCAAACTGCAGGGCCATGAGG - Intergenic
1049238771 8:141525946-141525968 AGGCACACAGCAATGGCAGGCGG + Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053356187 9:37447667-37447689 TTCAAAACAACAGTGGCAGGTGG + Intronic
1053416075 9:37947576-37947598 TGACAAACTGCAGAGTCAGGAGG - Intronic
1053946215 9:43312087-43312109 TGGCAAAAAGCCGTGGAAGCGGG - Intergenic
1055173646 9:73290898-73290920 TGACTGACAGCTGTGGCAGGAGG + Intergenic
1055846890 9:80576004-80576026 TAGCAAGGTGCAGTGGCAGGTGG + Intergenic
1056767195 9:89452108-89452130 TGGCACACAGGAGGGGCCGGTGG - Intronic
1056902324 9:90611602-90611624 GGAGAAACAGCAGTTGCAGGAGG + Exonic
1057832773 9:98419571-98419593 AGGCAAAGAGGAGTGGGAGGTGG + Intronic
1058880918 9:109285409-109285431 TGGAAGACAGCAGGGGCTGGGGG + Intronic
1058981975 9:110178483-110178505 TGGCAAACACCAGAGGCTGCAGG - Intergenic
1059771144 9:117427315-117427337 TGGGAATCAGCAGTGACAGAGGG - Intergenic
1061147576 9:128808871-128808893 GGGCAGAAAGCAGGGGCAGGAGG - Exonic
1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG + Intergenic
1061622169 9:131817759-131817781 TGGCAAACAACAATGGCACCTGG + Intergenic
1062154012 9:135036133-135036155 AAGCAAACACCAGGGGCAGGGGG + Intergenic
1062173578 9:135148656-135148678 TTGCACACGGCAGTGGCTGGGGG + Intergenic
1062395430 9:136350799-136350821 TGGCACACAGAGGTGGCGGGAGG + Intronic
1062402281 9:136377965-136377987 GGCCACACAGCAGTGGCTGGGGG - Exonic
1062569092 9:137176277-137176299 TGGCAAACACCAGAAGCTGGGGG + Intronic
1203589345 Un_KI270747v1:40645-40667 TGGCAAAAAGCCGTGGAAGCGGG - Intergenic
1185763681 X:2707660-2707682 GTGGAAACAGCAGTGGCAGTTGG + Intronic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1187313867 X:18173535-18173557 TGGGAAGCACAAGTGGCAGGTGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1189796611 X:44651730-44651752 TGGGAGACAGCAGTGGCAGGGGG + Intergenic
1190344077 X:49321886-49321908 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190345171 X:49331431-49331453 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190346265 X:49340997-49341019 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190347517 X:49532026-49532048 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190348618 X:49541582-49541604 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190349719 X:49551138-49551160 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190350823 X:49560691-49560713 TAGGAAACAGCAGAGGGAGGTGG + Intronic
1190351924 X:49570249-49570271 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190353025 X:49579798-49579820 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190354126 X:49589345-49589367 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190355228 X:49598869-49598891 TAGGAAACAGCAGAGGGAGGTGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193196586 X:78639430-78639452 TGGCAAAGAGCAGTGAGAGCAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199649918 X:149940257-149940279 TGGGAAAGAGCTGTGGGAGGAGG + Intergenic
1201284685 Y:12369004-12369026 TGGCAGGCAGCAGGGGCAGCCGG + Intergenic
1202075908 Y:21037863-21037885 TGGCAGACAGGAGTGGGGGGGGG - Intergenic