ID: 1142149184

View in Genome Browser
Species Human (GRCh38)
Location 16:88505264-88505286
Sequence TGGGCTGCCCTTCCACAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149184_1142149195 20 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149195 16:88505307-88505329 GAGGAGGCCAGTCCCTCCCCAGG 0: 1
1: 0
2: 3
3: 31
4: 307
1142149184_1142149193 4 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149193 16:88505291-88505313 CAGCTAGGGCCTCGGCGAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 158
1142149184_1142149196 21 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149196 16:88505308-88505330 AGGAGGCCAGTCCCTCCCCAGGG 0: 1
1: 0
2: 3
3: 30
4: 316
1142149184_1142149191 1 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149191 16:88505288-88505310 AGCCAGCTAGGGCCTCGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 121
1142149184_1142149198 29 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149198 16:88505316-88505338 AGTCCCTCCCCAGGGTCCTCTGG 0: 1
1: 0
2: 3
3: 44
4: 291
1142149184_1142149187 -10 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149187 16:88505277-88505299 GGGCAGCCCAGAGCCAGCTAGGG 0: 1
1: 0
2: 1
3: 35
4: 326
1142149184_1142149189 -4 Left 1142149184 16:88505264-88505286 CCCGTTTGTGGAAGGGCAGCCCA 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142149189 16:88505283-88505305 CCCAGAGCCAGCTAGGGCCTCGG 0: 1
1: 0
2: 1
3: 43
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142149184 Original CRISPR TGGGCTGCCCTTCCACAAAC GGG (reversed) Intronic
900293894 1:1938970-1938992 TGGGTTGGACGTCCACAAACTGG + Exonic
901732823 1:11292905-11292927 TGACCTGCCCTTCTTCAAACTGG + Intronic
902296893 1:15473750-15473772 TGGGGTGCCTATCTACAAACAGG - Intronic
903030607 1:20461645-20461667 TCTGCTCCCCTCCCACAAACAGG + Intergenic
903124266 1:21237029-21237051 AGGACTGGCCTTCCACACACAGG + Intronic
906576206 1:46892644-46892666 TGGGATGCCAATCCACAAACTGG - Intergenic
906595715 1:47074942-47074964 TGGGATGCCAATCCACAAACTGG + Intronic
912806880 1:112763863-112763885 TGGGCTGCCCCTGCACAAGGAGG + Intergenic
913419355 1:118647990-118648012 TGGGCTCCCCTTCCACACTGTGG + Intergenic
917212408 1:172644196-172644218 TGATCTGCCCTTCCCCTAACAGG - Intergenic
1062823188 10:549864-549886 TGGGCTGCCCTTCTACCAGAAGG - Intronic
1063731614 10:8703578-8703600 CGGGCTTTACTTCCACAAACAGG + Intergenic
1068570595 10:58624027-58624049 AGGGCTCCCATACCACAAACTGG + Intronic
1069858676 10:71456505-71456527 TGGACTGCCCCTCAACACACAGG + Intronic
1070785846 10:79161906-79161928 TGGGGTGCCCTGGCATAAACAGG - Intronic
1071064426 10:81614126-81614148 TGGCATGGGCTTCCACAAACAGG + Intergenic
1071078842 10:81785043-81785065 TGGGGTGCCCTTCCACGGTCTGG + Intergenic
1071814516 10:89219338-89219360 TGGGATGGCCTTCTTCAAACAGG + Intronic
1077584119 11:3437397-3437419 TGGGCTGCCCCTACCCAAATTGG - Intergenic
1077749108 11:4943995-4944017 TGGGCTGCCTATCCGCACACTGG + Intronic
1078013609 11:7593280-7593302 TGGGCTTCCCTTCCACTTAGGGG - Intronic
1078068140 11:8091289-8091311 TGGTGTGCCCAGCCACAAACTGG - Intronic
1079965370 11:26973713-26973735 TGGGCTCCCCTTCCCTACACAGG + Intergenic
1081639621 11:44743753-44743775 TGGCATGCCCATCCACAACCAGG - Intronic
1083643777 11:64160142-64160164 TGGGCTGACCCTTCTCAAACAGG + Intronic
1083959864 11:66008659-66008681 CGGCCAGCACTTCCACAAACTGG + Intergenic
1084241024 11:67820056-67820078 TGGGCTGCCCCTACCCAAACTGG - Intergenic
1084656268 11:70520997-70521019 TGAGCAGCCCTTCCTCACACTGG + Intronic
1084831419 11:71772562-71772584 TGGGCTGCCCCTACCCAAATTGG + Intergenic
1084982258 11:72836159-72836181 TGTGGGGCCCTTCCCCAAACAGG + Intronic
1085528700 11:77179143-77179165 TGGGCTGCTCTTGCCCAAACAGG + Intronic
1087160183 11:94941077-94941099 TTTCCTGCCCTTCCACAAAAGGG + Intergenic
1099178447 12:79450847-79450869 TAGGCTGCCCTTCCACGAAATGG - Exonic
1102769853 12:115466107-115466129 TGGGCTGCCCTTCCTCAGCGGGG + Intergenic
1106023883 13:25939673-25939695 AGGGCTGGCCCTCCACAACCTGG + Intronic
1109524462 13:63557377-63557399 TGGGCAGCCCTTTCACAGACTGG - Intergenic
1112726276 13:102308222-102308244 TGGGCTGCACATCCACCAAGTGG + Intronic
1113066032 13:106375037-106375059 TGGCCTGCCCTGCCACAAAGAGG - Intergenic
1113510707 13:110853030-110853052 TCGGTTGTCTTTCCACAAACAGG + Intergenic
1113650095 13:112028463-112028485 TGGGCTGTCCTCCCACTCACTGG - Intergenic
1113774425 13:112934726-112934748 GGGGCGGCCCTTCCACAGGCAGG + Intronic
1113807087 13:113116224-113116246 TGGGCTGCACTTCCAAAAGCAGG + Intronic
1114155672 14:20099956-20099978 TGGGGTCCCCTTCCACACAGCGG + Intergenic
1114866607 14:26602103-26602125 TGCGCTGCCCTTACACAGGCTGG + Intergenic
1117447529 14:55818944-55818966 TGGTCTGCCCTTTCCCAAAAAGG + Intergenic
1122898665 14:104772993-104773015 TCGCCTGCCCTTCTACAACCAGG - Exonic
1126408050 15:48343161-48343183 TTGCCTGTGCTTCCACAAACTGG - Exonic
1126866256 15:52940547-52940569 TGGGCTGTCATTCCACGAATAGG + Intergenic
1127805486 15:62515962-62515984 TGAGCTGCCCTTCCCCACCCAGG - Intronic
1128720836 15:69947249-69947271 TTGGCAGCCCTTCCACATCCAGG + Intergenic
1130095597 15:80853463-80853485 TGATCTGCCCTTTCACAAAATGG - Intronic
1132716283 16:1291713-1291735 AGGGCTCCCCTCCCACACACCGG - Intergenic
1133196074 16:4171502-4171524 TGTGCTCCCCTGCCAAAAACTGG + Intergenic
1133352498 16:5110960-5110982 TGGGATGCCCCTACCCAAACTGG - Intergenic
1133553209 16:6879270-6879292 TGGGCTGCCCTTCAGAAAACTGG - Intronic
1138571398 16:57875883-57875905 TGGGCTGGCCATCCACAGACAGG + Intergenic
1142149184 16:88505264-88505286 TGGGCTGCCCTTCCACAAACGGG - Intronic
1143233565 17:5378683-5378705 TGCTCTCCCCTTCCACACACTGG + Intronic
1143711245 17:8736650-8736672 TGGGTGGCCCTTCCCCAAAGAGG - Intronic
1144670617 17:17130694-17130716 AGGGCTGCCCTTGCACAACCAGG + Intronic
1147129894 17:38401176-38401198 TGGGCCACCCTTCCACAGTCAGG - Exonic
1151566663 17:74902328-74902350 TGGGCTGCTCCTCCACCCACTGG + Intergenic
1151774914 17:76193950-76193972 TGGGGTACACGTCCACAAACGGG + Intronic
1152091397 17:78249650-78249672 TGGGCTGGCCTCCCACAGACAGG - Intergenic
1161272700 19:3398760-3398782 CCGGCTGCCCTTGCATAAACTGG - Intronic
1161655657 19:5513060-5513082 TGGGCTGCCCTTCCTCACCTCGG - Intergenic
1166486858 19:43221326-43221348 TGGGGTCCCCTTCCACATAGTGG - Intronic
929561745 2:42960581-42960603 TGGGCTGCCCTTCCTGACCCAGG - Intergenic
932983383 2:76697886-76697908 TGGGTTTCCCTTCCACAATGTGG - Intergenic
934655550 2:96115308-96115330 TGGGCTGCCCTTCCCAACTCAGG - Exonic
935298846 2:101675174-101675196 TAGGCTTGCCTTCTACAAACGGG + Intergenic
936446806 2:112602462-112602484 TGGGCTGCCCTTCTGTCAACAGG - Intergenic
939041063 2:137190030-137190052 TGGACTGGCTTTCCACAAATGGG - Intronic
939869192 2:147507918-147507940 TGGGGTGCCCTTCCACACTGTGG + Intergenic
942249719 2:174037530-174037552 GGGGCTGCCCTAACACAAAGCGG - Intergenic
943790183 2:191922590-191922612 TGGGCTTCCCTTCCACATTGTGG + Intergenic
946172344 2:217902828-217902850 TGGGCTGCCCTCTCACTGACGGG + Intronic
948597530 2:239089934-239089956 TGGGCGGCCCCTCCCCACACTGG + Intronic
948900631 2:240955292-240955314 TGGGCTGCCCTCCCCCAGATGGG + Intronic
1169060086 20:2654753-2654775 TCGTCTGCACTTCCACAATCTGG + Exonic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1178759897 21:35392433-35392455 GGGGCTGCCACACCACAAACTGG - Intronic
1180713278 22:17854538-17854560 TGGGCTTGCCGTCCACAGACAGG + Intronic
1182453003 22:30432402-30432424 GGGGCTGCCCCTCCAGAAAGGGG + Intergenic
1183035704 22:35139511-35139533 TGGGCTGCTCTTCCAGGAAGGGG - Intergenic
950465896 3:13153496-13153518 AGGGCTGCCCTGCCACCAAGGGG + Intergenic
950668135 3:14509524-14509546 AGGGCTGACCTTCCAGACACAGG + Intronic
951451574 3:22845508-22845530 TTGGCTGCTCTTCCAGAATCAGG + Intergenic
952805710 3:37349433-37349455 TGGGCTACCCCTCCACCATCTGG - Intronic
953792340 3:45957876-45957898 TGGGCTGCCCTTCCGGGCACTGG - Intronic
955684621 3:61537599-61537621 TGGTCTGACCTTCCAAAGACAGG + Intergenic
960972143 3:123147548-123147570 TTTGCTGCCATTCCACAAGCTGG - Intronic
962158949 3:132978688-132978710 AGGGCAGCCCTTCAACAAAAGGG + Intergenic
971094468 4:23384957-23384979 CTGGCTGCTCTTCCACTAACTGG - Intergenic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
974076999 4:57176157-57176179 TGGGCTGGTCTTTCTCAAACGGG + Intergenic
974590447 4:63942402-63942424 TGGGGTTCCCTTCCACAATGTGG - Intergenic
978705125 4:111698764-111698786 TGGGCTTCTGTTCTACAAACAGG - Intergenic
980941624 4:139280201-139280223 CAGGCTGCCCTTCCACAGAGAGG + Exonic
981280723 4:142955047-142955069 TGGGGTGCCCTTCCACACTGTGG + Intergenic
985911051 5:2883665-2883687 TGGGCTGCCCTTCCTCACAAGGG - Intergenic
988915745 5:35892266-35892288 TGGGGTCCCCTTCCACAACGTGG - Intergenic
990189647 5:53244934-53244956 TGGGCTGCCCTTAAACAATAAGG + Intergenic
991005895 5:61827799-61827821 TGGGCTGCCCTCCAACTAACTGG + Intergenic
992071632 5:73154189-73154211 AGGGCAGCCCTTCCAGAGACAGG - Intergenic
992095510 5:73358980-73359002 TGGGGTGCCCTTACAAAAAGAGG - Intergenic
992953462 5:81883715-81883737 TGGGCCCCCCTTGCACACACAGG + Intergenic
993656622 5:90585614-90585636 TGGGCTCCCCTTCCCCTGACAGG - Intronic
997206582 5:132053779-132053801 TGTCCTGCCCTTTCCCAAACAGG - Intergenic
997399447 5:133591212-133591234 TGAGCTGCCCAGCCACAGACAGG + Intronic
998397386 5:141827459-141827481 TGGGCTGCCCTTCCTGGAAGAGG - Intergenic
998695077 5:144629759-144629781 TGGGCTGAACTTCAGCAAACTGG + Intergenic
999817521 5:155192480-155192502 TAGGCTGCCCTGCTCCAAACTGG + Intergenic
1003460138 6:6321069-6321091 GGGTCTGCCCTCCCACAGACAGG + Intergenic
1006335283 6:33417352-33417374 TGGGCTGCCAGTACAAAAACTGG - Intronic
1006832477 6:36977206-36977228 TGGCCTCCCGTCCCACAAACTGG + Exonic
1011418834 6:87151731-87151753 TGGGCAGCCCAGCCACAGACAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1020021916 7:4874291-4874313 TGGACAGCCCTGCCTCAAACAGG - Intronic
1020509467 7:9035267-9035289 TGGACTGCTATTCCAGAAACAGG - Intergenic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1026842182 7:73675916-73675938 TTTGCTGCACTTCCACCAACAGG - Intergenic
1028387592 7:90275299-90275321 TGGGCTGCCATACCTCAAAAAGG - Intronic
1032202730 7:129834171-129834193 TGTGCTGTCCTTTCAAAAACAGG + Exonic
1032845693 7:135749617-135749639 TGGGCACCACCTCCACAAACTGG - Intergenic
1035724220 8:1814478-1814500 TGGCCTGCCCTCCATCAAACGGG + Intergenic
1036941484 8:13056726-13056748 TGGGCTGCCCTGTCTCAAACAGG - Intergenic
1038206972 8:25476028-25476050 TGTGCTGCCCTTCTCCCAACTGG - Intronic
1043070766 8:75633102-75633124 AGGGCTGCTCTGACACAAACTGG + Intergenic
1043737749 8:83768794-83768816 TGGGCTGCCAATCCATAGACAGG - Intergenic
1044853686 8:96453081-96453103 TGGGGTCCCCTTCCACACAGTGG + Intergenic
1045547514 8:103141334-103141356 TGGGCTGTCCTCCCACCCACCGG - Exonic
1049608195 8:143539440-143539462 GGGGCTGCCCCTCCTGAAACTGG - Intronic
1049609820 8:143549698-143549720 TGCGCTGCCCTTCCGAACACCGG - Intergenic
1052395446 9:27932916-27932938 TAGGCTACCCTTCCACCAAGGGG + Intergenic
1057073330 9:92119390-92119412 TGTGCTGCCCTTCAAGAAAAAGG - Intergenic
1060523709 9:124308864-124308886 TGGGCTGGTCGTCCACACACAGG - Intronic
1062280798 9:135750819-135750841 TGGGCTCCCCTCCCACACCCGGG - Intronic
1192432938 X:71124995-71125017 TGGACTGCCCTTCCCCTCACAGG - Exonic
1193271207 X:79531528-79531550 TGGGCTTCCCTTCCACATTGTGG + Intergenic
1196754283 X:119144211-119144233 TGGGCTGTCCTGCCATACACTGG + Intronic
1199493883 X:148431471-148431493 TAGGAGGCCATTCCACAAACTGG - Intergenic
1199843555 X:151674634-151674656 AGGCCTGCCCTTCCAAATACGGG - Intronic
1201555389 Y:15260945-15260967 TGGGGTCCCCTTCCACAATGTGG + Intergenic