ID: 1142149981

View in Genome Browser
Species Human (GRCh38)
Location 16:88508457-88508479
Sequence TGTGGCCTGCTCTGCAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 361}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149981_1142149991 19 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149991 16:88508499-88508521 GGGCTCCACGTGGGTTCCCCTGG 0: 1
1: 0
2: 3
3: 11
4: 145
1142149981_1142149982 -8 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149982 16:88508472-88508494 AGGCCACAGAGTCCAACCACAGG No data
1142149981_1142149985 -1 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149985 16:88508479-88508501 AGAGTCCAACCACAGGCCTTGGG 0: 1
1: 0
2: 1
3: 7
4: 138
1142149981_1142149994 30 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149981_1142149993 29 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149993 16:88508509-88508531 TGGGTTCCCCTGGTCTCTCCTGG 0: 1
1: 0
2: 1
3: 36
4: 239
1142149981_1142149989 10 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149989 16:88508490-88508512 ACAGGCCTTGGGCTCCACGTGGG 0: 1
1: 0
2: 2
3: 12
4: 113
1142149981_1142149988 9 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149988 16:88508489-88508511 CACAGGCCTTGGGCTCCACGTGG 0: 1
1: 0
2: 2
3: 18
4: 234
1142149981_1142149984 -2 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149984 16:88508478-88508500 CAGAGTCCAACCACAGGCCTTGG 0: 1
1: 0
2: 0
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142149981 Original CRISPR TGTGGCCTGCTCTGCAGCCA CGG (reversed) Intronic
900104155 1:975238-975260 TGTTCTCTGCTCAGCAGCCAGGG + Exonic
900154593 1:1198869-1198891 CCTGCCCTGCTCCGCAGCCACGG + Intergenic
900204647 1:1426801-1426823 TGTGGCCTGCTCTGGGCCCCGGG + Intronic
900542921 1:3212965-3212987 TGTGTCCAGCTCTGCTGCCAGGG - Intronic
900579423 1:3401194-3401216 TGTGGGCTGCTTTGCAGTCTGGG - Intronic
901524132 1:9808764-9808786 TGTGGGCTGCTCAGATGCCAGGG + Intronic
902210849 1:14903411-14903433 GATGGCCCGCTCTGCTGCCAGGG - Intronic
904362496 1:29985739-29985761 AGTGGCCAACTCTGGAGCCAAGG + Intergenic
904409263 1:30315057-30315079 TGTCGCCTCCTCTCCAGCCCTGG - Intergenic
905690824 1:39941373-39941395 TTGGGCATGCTCTGCAGCAAGGG - Intergenic
907132316 1:52108030-52108052 TGCGGACTGCTCTCCAGCCTGGG - Intergenic
907501693 1:54886164-54886186 TGGAGCCTCCTCTGCATCCAGGG - Intronic
907564920 1:55425709-55425731 TGTGGGCTGCTCTCCACCTAGGG + Intergenic
907945254 1:59130065-59130087 AGAGGCCTCCTGTGCAGCCAAGG + Intergenic
908120122 1:60978466-60978488 TGTAGACTGCTTTGCATCCAAGG - Intronic
908461009 1:64348343-64348365 TGGGGGCTGCTCTGCAGCCCTGG + Intergenic
912691209 1:111805784-111805806 GCTGCCCTGCTCTGCAGCCGCGG - Intronic
912985902 1:114430286-114430308 TGTGTCCTGCACTCCAGCCTGGG - Intronic
915724562 1:158008281-158008303 TGGGGCCTGCTGGGCAGCCCAGG - Intronic
918242776 1:182634893-182634915 CTGGGCCTGCTCTGCAGCCATGG - Intergenic
919778169 1:201207341-201207363 TGTGACCTGCTGTCCAGCCCTGG - Exonic
920550775 1:206859037-206859059 TGTCTCTTGCTCTGCAGGCACGG + Intergenic
922180660 1:223230573-223230595 GGTGGCCTGCTCTGCAGGGAGGG - Intronic
923025010 1:230197078-230197100 AGAGGCTTGCTCTGAAGCCAGGG - Intronic
923086291 1:230705818-230705840 CCTGCCCTGCTCTGCACCCAAGG + Intronic
923145165 1:231192705-231192727 TGTGCCCTGGTCTGCAGCCATGG - Intronic
923839868 1:237658415-237658437 TGAGTCCTGCTCTGCTGCCCAGG + Intronic
924735529 1:246752350-246752372 ACTGGCCTGCTTTGCAGCTAGGG - Intronic
1064470330 10:15629009-15629031 TGTTACCAGCTCTGCAGCCTGGG - Intronic
1065258325 10:23897548-23897570 TTTGACCTGCTATGGAGCCAGGG + Intronic
1065665097 10:28050553-28050575 TGTTTCCAGCTCTGCAGCCTTGG - Intergenic
1067250467 10:44582162-44582184 TGGGGCCTGCTCTGCTGTCCCGG + Intergenic
1067263569 10:44715744-44715766 AGTGGCGTGCTCTGCACTCAGGG - Intergenic
1067569220 10:47359532-47359554 TGTGGCCTGACCTGCAGCTAGGG + Intergenic
1067667990 10:48294870-48294892 GGTGGCATGCACTGCAGCCTAGG + Intergenic
1069164069 10:65127660-65127682 TGAGGCCTGCACTCCAGCCTGGG - Intergenic
1070551339 10:77493182-77493204 GGTCTCCTGATCTGCAGCCAGGG - Intronic
1070827172 10:79398066-79398088 TGTGGGCTGCTTGGCAGGCAAGG + Intronic
1071547578 10:86540016-86540038 TGTGGGCTGCTCCACAGCAATGG + Intergenic
1073206093 10:101770226-101770248 TGTGCGCTGCTCTGCAGGCTGGG - Intronic
1074831152 10:117250327-117250349 ATTGGCTTGCTCTGCAGCCATGG + Intronic
1075944278 10:126418806-126418828 TGTGGTCTACTTTGCAGCCCTGG - Intergenic
1076057508 10:127387518-127387540 TGTCACCTGTTCTCCAGCCACGG + Intronic
1076120613 10:127934226-127934248 TGTGAACTCCTCTGCAGACATGG - Intronic
1076360075 10:129881878-129881900 TGTGGCCACCACTGCACCCAAGG + Intronic
1076662025 10:132062080-132062102 TGTGGCGTGCTCATCATCCATGG - Intergenic
1076720287 10:132389424-132389446 TGGGGGCTGCTCTCCATCCAGGG + Intergenic
1077329439 11:1977467-1977489 TGTGGCCGTCTGTCCAGCCAGGG + Intronic
1077353304 11:2102999-2103021 TGCTGCCTTCCCTGCAGCCAAGG + Intergenic
1077385445 11:2267498-2267520 TGGGGGCTCCTCAGCAGCCAAGG - Intergenic
1077393489 11:2310313-2310335 TGGGGCCTGCTCTCCAGGAAGGG + Intronic
1077482212 11:2821082-2821104 TCCGGCCTGCTCTGCTGCCTTGG + Intronic
1077745446 11:4899066-4899088 TGTGGCCTGCTCACCAACAAGGG + Intronic
1078699775 11:13669053-13669075 TGGGGCCTGGTTTGCAGCCGCGG + Intronic
1079072299 11:17357748-17357770 TGTGCCATGCTCTCCAGCCTGGG - Intronic
1079096815 11:17516464-17516486 TTAGGCCTGTTCTGCAACCAAGG - Intronic
1079639952 11:22792736-22792758 TGTGACCAGCTCTGAAGCAAGGG + Intronic
1080643281 11:34170662-34170684 AGTGGCCAGCTGTCCAGCCAGGG + Intronic
1082160868 11:48886307-48886329 TGTGTCCCTCTGTGCAGCCAAGG - Intergenic
1082161498 11:48894099-48894121 TGTGTCCCTCTGTGCAGCCAAGG + Intergenic
1082821960 11:57550147-57550169 GGTGCCCAGCTCAGCAGCCACGG + Exonic
1083331587 11:61900859-61900881 TGGGGCCTGCTGTTGAGCCATGG + Intronic
1084066550 11:66707690-66707712 GGCGGCCAGCTCTGCAGCCACGG + Exonic
1084302567 11:68261138-68261160 TGTGGCCTCCTCTGGGGCCCAGG + Intergenic
1084395969 11:68910537-68910559 TGTGCTCAGCCCTGCAGCCATGG - Intronic
1084940926 11:72612889-72612911 TCAGGCCTCCTCTGAAGCCAGGG + Intronic
1085250846 11:75142838-75142860 TCTGGCCTGCTCTCTGGCCAGGG - Intronic
1086488563 11:87335155-87335177 TGTGCCCTGCACTCCAGCCTGGG - Intergenic
1087107415 11:94423968-94423990 TGTGGCCTGTCTGGCAGCCATGG + Intronic
1088943403 11:114484007-114484029 TGTGGCCTGTTTTCCAGTCAAGG + Intergenic
1089620822 11:119721243-119721265 TGTGTCCTCCTCTTCAGGCAGGG + Intronic
1090460068 11:126883176-126883198 TGTCTCCTGCTCAGCTGCCAAGG - Intronic
1090514802 11:127413007-127413029 TATGCCCAGGTCTGCAGCCATGG + Intergenic
1090754619 11:129779028-129779050 TGAGACCTGCTCTGCTGCCGAGG - Intergenic
1202812419 11_KI270721v1_random:32646-32668 TGTGGCCGTCTGTCCAGCCAGGG + Intergenic
1091968505 12:4765605-4765627 TGAGTCTTGCTCTGCAGCCCAGG + Intronic
1094599711 12:31898013-31898035 TGTGGCCGCCTCTGCTGCCCCGG + Intergenic
1102046342 12:109832534-109832556 TGGGGCCAGCTCTGCACACAGGG - Intronic
1102189867 12:110979467-110979489 TGGGTCCTGCTCTGTTGCCAAGG - Intergenic
1102456171 12:113072005-113072027 GTTGGCCAGCTCTGCAGCAAAGG - Intronic
1103030616 12:117609141-117609163 TGTGGCCCATTCTGGAGCCAGGG - Intronic
1103315622 12:120052813-120052835 TGTGCCCTGCACTCCAGCCTGGG - Intronic
1103377534 12:120468989-120469011 TGCAGCTTGCTCTCCAGCCACGG + Intronic
1103796390 12:123506123-123506145 AGAGGCCTGCCCTGCACCCATGG - Intronic
1103848020 12:123913018-123913040 TGTGGCCTGGTTTGAGGCCATGG + Intronic
1104728701 12:131093495-131093517 TGTGCCCTTCCCTGGAGCCAGGG - Intronic
1104846704 12:131850654-131850676 TGTGGGCAGCTCTGCAGGCATGG - Intronic
1105291201 13:19054873-19054895 TGGGGCCAGCTCTGCCACCAAGG - Intergenic
1105570111 13:21594835-21594857 TGTTCCCTTCTCTGCATCCATGG - Intronic
1108216611 13:48191531-48191553 TGTTGCCTGCTCTTCAGCAAAGG + Intergenic
1108260861 13:48654718-48654740 TCTGGCCAGATGTGCAGCCAGGG - Intronic
1110419773 13:75293109-75293131 TGTGCCCTGCACTCCAGCCTAGG + Intronic
1111674395 13:91368933-91368955 TATGGCCTGCACTGCAGAAATGG + Intergenic
1112615828 13:101004464-101004486 TGAGGTCTGCTCTGCTGCAAAGG - Intergenic
1113208129 13:107941488-107941510 TGTGGCCTGATCTCCAGCAGGGG + Intergenic
1113796845 13:113063344-113063366 TGTGGGCGGCTGTGCAGGCAGGG - Intronic
1113896588 13:113768489-113768511 GGTGGCCTGTGCTGCAGCCCGGG + Intronic
1114135215 14:19840411-19840433 GGTGGACAGCTCAGCAGCCAGGG + Intergenic
1118550682 14:66946447-66946469 TGTGTCCTGCACTCCAGCCTGGG - Intronic
1121009676 14:90512595-90512617 TGTGGCCTGGACTGCAGGCAGGG - Intergenic
1121407349 14:93727326-93727348 TGAGCACTGCTCTGCAGCCTGGG + Intronic
1122036551 14:98953480-98953502 TGTGGCCTCCTCAGCAGGCCAGG - Intergenic
1122536982 14:102472216-102472238 TGTGCACCTCTCTGCAGCCATGG + Intronic
1122575208 14:102737641-102737663 TCTGGGCTCCTCTGCAGCCCTGG + Intergenic
1122862660 14:104589464-104589486 TGTGCCCAGCTCTGCAGGCCAGG + Exonic
1122915562 14:104856823-104856845 AGCGCCCTGCTTTGCAGCCACGG - Intergenic
1123008618 14:105336377-105336399 CGTGGCCAACTCTGCAGCCCTGG - Intronic
1123029494 14:105445023-105445045 GGTGACCTGCACAGCAGCCACGG - Intronic
1123722708 15:23073885-23073907 TGTGTCCTCATCTGCAGCGAAGG + Intergenic
1123971617 15:25513193-25513215 GGTGGCTTGCAATGCAGCCATGG - Intergenic
1124630755 15:31335779-31335801 TGTGGCCTACTCTGCATGGATGG + Intronic
1125510961 15:40292036-40292058 TGTTGCCTGCACTGCTGCCAGGG - Intronic
1125911285 15:43442050-43442072 TCTGGCCTGCACTGCAGCCTGGG - Intronic
1125979577 15:43988186-43988208 TGTGGCCTGGTCTGTGGCCTGGG + Intronic
1126942458 15:53781299-53781321 TCTTGCATGCTCTGAAGCCATGG + Intergenic
1128166917 15:65473623-65473645 TGTGCCCTGCACTACAGCCAGGG + Intronic
1128724813 15:69980501-69980523 TGAGGCTGGCTCTGCAGCCAGGG + Intergenic
1129601462 15:77001286-77001308 TGGGGCCAGTTCTCCAGCCATGG + Intronic
1129633587 15:77290166-77290188 TGTGGACTGCGCTTCAGCCTGGG - Intronic
1129855000 15:78817311-78817333 TGTTGCCTGCTCTGTTGCCCAGG - Intronic
1130957708 15:88639134-88639156 TCTGGCCTGCCCCGCAGCCTGGG - Intronic
1132414696 15:101612013-101612035 AGTGGCCTGCCCTGCCACCAGGG - Intergenic
1132467140 16:82560-82582 TGTGGCCACCTCAGCAGCCCAGG + Intronic
1134823426 16:17265142-17265164 CGTGCCCTGCACTGCAGCCTGGG + Intronic
1137264854 16:46860254-46860276 TGGGTCCTGGTCTGCAGCCCAGG - Intergenic
1137359643 16:47802158-47802180 TGTGGAATGCTATGCAGCCATGG + Intergenic
1137540449 16:49358124-49358146 TGTGGTGTGCACTCCAGCCAGGG - Intergenic
1137937052 16:52644821-52644843 TGTGCCCAGCTCTGCAGCCAGGG - Intergenic
1138134629 16:54511083-54511105 TCTGGCCGGCTGTGCAGGCAGGG - Intergenic
1140219041 16:73030385-73030407 TGTGGTCTGCTCTCCTTCCATGG - Intronic
1140357116 16:74315976-74315998 CGTGGCCTTCTCTGGAGCAAAGG - Intergenic
1140517807 16:75556847-75556869 AGTGGCCGGCTCTGGAGCCCAGG + Intergenic
1141811918 16:86381656-86381678 TGTGGCTTCCTGGGCAGCCATGG - Intergenic
1142149684 16:88507125-88507147 TATGGCCTGGGCTGCAGACATGG + Intronic
1142149981 16:88508457-88508479 TGTGGCCTGCTCTGCAGCCACGG - Intronic
1142153864 16:88524414-88524436 TGAGCCCTGCTCTGCGGCCCTGG + Intronic
1142706303 17:1696995-1697017 TGTGTCCTGCACTCCAGCCTGGG - Intergenic
1142958414 17:3536137-3536159 TGGGGCCAGCTCATCAGCCAGGG + Intronic
1143285567 17:5786522-5786544 TGTCTCCGGCTCTTCAGCCAGGG - Intronic
1143388560 17:6546523-6546545 TGTGGCCTGGCCTGTGGCCATGG - Intronic
1145784624 17:27585976-27585998 TCTGGCCTGCTGGGCTGCCACGG + Intronic
1148984782 17:51611992-51612014 TGTATCCTGCTCTGCACCCCAGG - Intergenic
1150251089 17:63704829-63704851 TGAGCCCTGCTTTCCAGCCATGG - Intronic
1151153404 17:72107346-72107368 TGTGGACTTGTGTGCAGCCAAGG + Intergenic
1151314992 17:73316475-73316497 TGCGGACTGCACTGCAGCCTGGG - Intergenic
1151563323 17:74882678-74882700 CGTGGCGTGCTCTGCAGTGAAGG + Exonic
1151729915 17:75904985-75905007 TGAGGCCTGCTCCGCAGCGCGGG - Exonic
1152164957 17:78697654-78697676 TGTGGATTGAGCTGCAGCCAAGG + Intronic
1152633549 17:81421261-81421283 TGTAGCCTGGGCTCCAGCCAGGG - Intronic
1152664209 17:81558009-81558031 TCTGGGCTGCTCTGCACCCACGG - Exonic
1203213531 17_KI270730v1_random:102824-102846 TGTGCACTGCACTCCAGCCAGGG + Intergenic
1153775705 18:8451449-8451471 TGGGGCCGGCTCTGCAGGCAGGG - Intergenic
1154459342 18:14564369-14564391 GGTGGACGGCTCAGCAGCCAGGG + Intergenic
1154492584 18:14933218-14933240 TGTAGCCTCCTCTGCATGCAGGG + Intergenic
1155005764 18:21727709-21727731 TGTGAGCTGCACTGCAGCCTGGG + Intronic
1157061030 18:44290648-44290670 AGTGGACTGCTTTGCAGCCTGGG - Intergenic
1157128328 18:44978748-44978770 TGTTTCCTGCACTGCAGACATGG + Intronic
1157815717 18:50728324-50728346 GTTCGACTGCTCTGCAGCCATGG - Intronic
1158625658 18:59069606-59069628 TGTGGCCTTATTTGGAGCCAGGG + Intergenic
1158688256 18:59634470-59634492 GGAGGCCTGCTCTCAAGCCAGGG + Intronic
1160038564 18:75322598-75322620 TGGGGCCTGCCCTGCACCCACGG + Intergenic
1160070158 18:75621421-75621443 TGTGGCCTGACCTTCAGCCAAGG + Intergenic
1160183867 18:76659814-76659836 TGTGGCCTGTATTGCAGCCTGGG + Intergenic
1160355781 18:78227228-78227250 TGAGGCCTTCTGTGCATCCAGGG - Intergenic
1160585830 18:79912887-79912909 AGGGGCCTGCTCTGCATCAAAGG + Intronic
1161443322 19:4304728-4304750 GGTGACCTGGGCTGCAGCCATGG + Exonic
1162016831 19:7850761-7850783 TGGTGCCTTCTCTGCAGCCCAGG - Intronic
1162428145 19:10609847-10609869 TGTGCCCTGCCCTTCAGCCTGGG - Intronic
1162781062 19:13007232-13007254 TCTGGCCTTCTCTGCCGCCTGGG + Intronic
1163163544 19:15480045-15480067 TGAGGCCTGCTCTGAGCCCATGG + Intronic
1163455655 19:17404399-17404421 TTGGGCCTTCTCTGCATCCAGGG + Exonic
1163485598 19:17583546-17583568 TGTGTCTTGCTCTGCCGCCCAGG - Intergenic
1164826073 19:31285754-31285776 AGTGGCTTGCTCTGCTGCCCAGG - Intronic
1165019218 19:32909344-32909366 AGAGGCCTGCTCAGCAGCCAGGG + Intronic
1165807925 19:38593115-38593137 TGTTCTCTGCACTGCAGCCACGG - Intronic
1166082771 19:40454865-40454887 AGGGTCTTGCTCTGCAGCCAAGG + Intronic
1166106767 19:40601508-40601530 TGCGGCCTGCGCTGCGTCCATGG + Intronic
1166298893 19:41903295-41903317 TGTGGGCTCTTCTGCAGGCAAGG - Exonic
1166503271 19:43356128-43356150 TGTGCCCTGGACTGCAGCCTCGG + Intronic
1166507183 19:43378633-43378655 TGTGCCCTGGACTGCAGCCTCGG - Intergenic
1166663496 19:44662740-44662762 TGTGGTCTGCTATGCAGTAAAGG - Exonic
1167074246 19:47239503-47239525 TGTGGCCGGCCCTGCAGGCCGGG + Intergenic
1167496705 19:49823581-49823603 TAGGGCCTGGTCTGCAGTCAAGG + Intronic
1167506117 19:49871944-49871966 TGTGTCCTCCTCCTCAGCCACGG + Intronic
1167579173 19:50331948-50331970 TGGGGCCTGTCCTGCAGCCCAGG + Intronic
925140836 2:1549077-1549099 TGTGTCCTGCTGGGCACCCAGGG + Intergenic
925924313 2:8659453-8659475 AGAGGCCTGCTCAGCAGCCAGGG - Intergenic
926969118 2:18449082-18449104 TGTGGCCTGGCCTGGAGCCTGGG - Intergenic
927211645 2:20642535-20642557 CGTGGCCTGCTCTGCGGGCCGGG - Intronic
927520463 2:23695294-23695316 AGTGGCCTGATCTGCAGCAGGGG + Intronic
927653754 2:24928522-24928544 TGTGGCCTGCTCGACATCCTGGG + Intergenic
927743305 2:25591232-25591254 AGATGCCTGGTCTGCAGCCATGG + Intronic
928087538 2:28355359-28355381 GGTGGCCTGGCCTCCAGCCAGGG - Intergenic
928168819 2:28990402-28990424 CGGGGCTTGCTCTGCAGCCCCGG - Intronic
928526165 2:32143222-32143244 TGTGCCCTGCACTCCAGCCTGGG + Intronic
930019088 2:46990289-46990311 TGTGGCCTGCTCTCCAGCTCTGG + Intronic
930765208 2:55078262-55078284 TGAGGCTTGCTCTGCTGCCCAGG + Intronic
930920978 2:56753404-56753426 TGTGGCATGATCTGCAGCCCTGG + Intergenic
934040912 2:88126821-88126843 TGTGTCCACCTCTGCAGTCAAGG + Intronic
934746027 2:96760539-96760561 GGTGGCCCGCTCTGCAGGCAGGG - Intergenic
935070812 2:99692132-99692154 TGTGGCTGCCTCTGCAGCCCTGG + Intronic
935803896 2:106727927-106727949 TGTGTCCTCCTCTGCCACCACGG - Intergenic
936009697 2:108917681-108917703 TGAGGTCAGCCCTGCAGCCAGGG - Intronic
936232910 2:110719974-110719996 TGTGGCATGGTGTGCTGCCATGG + Intergenic
936280153 2:111132075-111132097 TGTGCCTTGCTCTTCTGCCATGG + Intronic
936725387 2:115308763-115308785 TGTGCGCTGCTCTGCAGTGAGGG + Intronic
936895732 2:117425418-117425440 TGTGGCCTTGTTTGGAGCCAGGG + Intergenic
937376331 2:121338346-121338368 TGCTGCCTCCCCTGCAGCCAGGG - Exonic
938922922 2:136011698-136011720 TGTGGATTGTTCTCCAGCCATGG - Intergenic
939525565 2:143289557-143289579 TGTGCCCTGCTTTCCAACCAGGG - Intronic
941442165 2:165552070-165552092 ACTGGCCTGCTCAGCAGCCTGGG - Intronic
946174963 2:217916941-217916963 TGTTGCCTGCCCTTCAGCCTCGG - Intronic
946683072 2:222238289-222238311 TGTGACCTCCTCTGTAGCCTCGG + Intronic
946846741 2:223865804-223865826 TGTGCACTGCACTGCAGCCTGGG + Intronic
947876622 2:233471815-233471837 TGGGGGCTGCTCTGCTGCCCCGG + Exonic
947952343 2:234159286-234159308 AGTGGTCTGTTCTGCAGCTATGG - Intergenic
948212747 2:236207156-236207178 TGGGTCCTGCTCTGCATCCTGGG - Intronic
948483754 2:238267181-238267203 TGTGACTCGCTCAGCAGCCAAGG + Intronic
948767848 2:240232812-240232834 TGCGGCCGGCTCTGCCCCCAGGG + Intergenic
948831524 2:240600697-240600719 TGTGGCAGGCTCTGCACGCAGGG - Intronic
948922069 2:241070531-241070553 AGTGGCCTGCATTGCAGCCCAGG + Intronic
1169022755 20:2341747-2341769 TAAGGCCTGCGCTGCACCCAGGG - Intergenic
1170695256 20:18652031-18652053 TGAGGCCTTCTCAGAAGCCATGG - Intronic
1170839711 20:19914684-19914706 TGTGGTCTGCCCGTCAGCCATGG + Intronic
1172530451 20:35627303-35627325 TGTGGCCAGGTTTGCAGCCCAGG - Exonic
1173186658 20:40845376-40845398 TGTGCCCTGCACTCCAGCCTGGG + Intergenic
1173715808 20:45204424-45204446 TGTGCCAGCCTCTGCAGCCATGG - Intergenic
1174052028 20:47773538-47773560 TGTGGCCTGCCCAGAAGGCATGG - Intronic
1174276085 20:49405298-49405320 TGTTGCCTCCTCTGCTTCCAAGG + Intronic
1175436950 20:58959627-58959649 TGTGGCTTGTTTTCCAGCCAGGG - Intergenic
1175834959 20:61987611-61987633 TGTTGCCTTCCCAGCAGCCACGG - Intronic
1175937624 20:62521603-62521625 TGTTGCCTTCCCAGCAGCCACGG + Intergenic
1176814801 21:13588969-13588991 GGTGGACGGCTCAGCAGCCAGGG - Intergenic
1177929400 21:27262306-27262328 TGTGGCCACCTCTGCTGCAATGG - Intergenic
1179509456 21:41862677-41862699 TCAGGCCTGATCTGCAGCCCAGG - Intronic
1179978333 21:44883459-44883481 TGAGGCTTGTTCTGCTGCCAAGG + Intergenic
1181309993 22:21939482-21939504 TGTTGCCTGCTAAGCAGCCCTGG + Intronic
1181339267 22:22165351-22165373 AGGGCCCTGCTCTGCAACCATGG + Intergenic
1181772865 22:25139337-25139359 TGAGGCCTCCTCTGTAACCAGGG - Intronic
1182156203 22:28075465-28075487 TGTGGCCTCCTCTCCTACCATGG - Intronic
1182951216 22:34377714-34377736 TGTGGCCTTCTCTAGAGCCAAGG - Intergenic
1183109520 22:35638662-35638684 TGAGGCCTGCACGCCAGCCAGGG - Intergenic
1184402960 22:44284571-44284593 TGGGGGCTGAGCTGCAGCCATGG - Intronic
1184517234 22:44970256-44970278 TGTGACCTGCTCTGCACAGAAGG + Intronic
1184518867 22:44980472-44980494 TGTGGCCTGTGCTGCATCCCTGG - Intronic
1184837938 22:47035179-47035201 TGCAGGCTGCTCTGCTGCCAGGG + Intronic
1184997790 22:48223152-48223174 TGTGGCCTCCCCTGCAGCTCAGG - Intergenic
1185208715 22:49554829-49554851 TCTGGCCTTCTCTCCAGCCCCGG + Intronic
1185233966 22:49700299-49700321 TCGGGCCTGCTCTGAAGTCATGG + Intergenic
1185345118 22:50307607-50307629 TCTGGCCCGCGCTGCTGCCATGG + Exonic
949928366 3:9059422-9059444 TGGGGCCCCCTCTGGAGCCACGG + Intronic
950017734 3:9766027-9766049 TGTGACCATCTCTGGAGCCAGGG - Exonic
950127734 3:10520511-10520533 TGTGCCCTGCACTCCAGCCTGGG - Intronic
950222750 3:11208701-11208723 TGTGGCTTTCTCTGCTGACATGG - Intronic
950863131 3:16168309-16168331 TCTGGCCTGCTCTGCATGAACGG + Intergenic
952657995 3:35809392-35809414 GGTGGCCTTCTCTGCAGGCCAGG - Intergenic
953469957 3:43158136-43158158 TGTGACCTGCACTGTCGCCAGGG + Intergenic
954244490 3:49319958-49319980 TGTGCACTGCACTGCAGCCTGGG - Intronic
955586074 3:60479607-60479629 TGGGCACTGATCTGCAGCCAGGG - Intronic
957519661 3:81302018-81302040 GGAGTCTTGCTCTGCAGCCAAGG - Intergenic
959825659 3:110792971-110792993 TGTGCCCTGCTCTGGATCCCTGG + Intergenic
962178985 3:133185633-133185655 TGCTCCCTGCTCTACAGCCAGGG - Intronic
962532343 3:136294651-136294673 TGTGTCCTGCACTCCAGCCTGGG - Intronic
963043758 3:141087698-141087720 TGTGGCTTGGTATGCAGCCCTGG - Intronic
964357141 3:155861194-155861216 TGAGTCCTGCTCTGTAGCCCAGG - Intergenic
967014975 3:185473522-185473544 TCTGGCCTGCACTGAAGGCAGGG - Exonic
967598986 3:191361865-191361887 TGGGGCCTGCACAGGAGCCAGGG + Intronic
968117727 3:196102323-196102345 GGTGCCCTGCACTGCAGCCTGGG + Intergenic
968431387 4:561146-561168 TGTGGGAAGCTCTGCAGCAAGGG + Intergenic
968706386 4:2080340-2080362 TGTGGCCTGGGGGGCAGCCAGGG + Intronic
969233741 4:5850691-5850713 AGGTGCTTGCTCTGCAGCCAGGG - Intronic
969278698 4:6154643-6154665 TGTGCCCAACTCTGCAGCCCTGG + Intronic
969573717 4:8024618-8024640 CCTGTCCTCCTCTGCAGCCATGG - Intronic
969616863 4:8258348-8258370 TGTGACCTGAGCTCCAGCCAAGG + Intergenic
971359416 4:25922932-25922954 GGCTGCCTGCTCTGCAACCATGG - Intronic
972626915 4:40808342-40808364 TTTGGCCCGAGCTGCAGCCAAGG + Exonic
975359119 4:73446111-73446133 TCAGGCCTCCTCTGCAGCCTTGG - Intronic
975610506 4:76198051-76198073 TGCGGTCTGCTCTGCTGCAAAGG + Intronic
978704201 4:111685914-111685936 TGTGGCCTTCTTTGTAACCATGG + Intergenic
979543473 4:121913451-121913473 TGTGGCATGCTCTGCAGAGAAGG - Intronic
980189941 4:129511508-129511530 TGTGGACTGCACTCCAGCCTGGG - Intergenic
980981659 4:139659343-139659365 TGAGGCCTTCTCAGCAGCCCTGG + Intergenic
984031452 4:174609582-174609604 TGTGTCTTGCTCTGTAGCCCAGG + Intergenic
985489478 5:171094-171116 GATGCCCTGCTCAGCAGCCATGG + Exonic
985570762 5:643605-643627 TGGGGCCTGCTCAGCACCCCCGG + Intronic
986030824 5:3890990-3891012 TGTAGCCTGCCCTGCACCCCAGG - Intergenic
986735061 5:10662283-10662305 CCTGTCCTGCTCTGCTGCCATGG - Intergenic
989300691 5:39888972-39888994 TGTGGCAGTCTCAGCAGCCAGGG + Intergenic
990320238 5:54622474-54622496 AGTGGCTTGCTCTGTAGCCCAGG - Intergenic
990450235 5:55926574-55926596 TGAGGCCTGCACTCCAGCCTAGG + Intergenic
995135284 5:108673719-108673741 GGTGGCCTCCTCTGCAGGCCAGG + Intergenic
996818382 5:127598125-127598147 TGTGGTCTGCTCAGCAGGGAGGG + Intergenic
997335316 5:133104357-133104379 TGTACCCTGCTCAGCAGCCTGGG - Exonic
998567633 5:143230427-143230449 TGCAGCCTGCACAGCAGCCAAGG + Intergenic
998907998 5:146927531-146927553 TGTGGCCTTTCCTGCAGGCAAGG + Intronic
999723195 5:154413727-154413749 TGTGCCATGCACTGCAGCCTGGG + Intronic
1000184570 5:158846592-158846614 TTTGGCCTGCTCTGTTGCAAGGG - Intronic
1001895929 5:175380925-175380947 TGTGGCCTACACTGCTGACAAGG - Intergenic
1002181715 5:177434180-177434202 TCTGGCCTGATCGGCAGCCTTGG - Intronic
1002453586 5:179332928-179332950 TGTGGACAGCCCTGCAGCAAAGG + Intronic
1002569541 5:180132328-180132350 GGTGGCCTGGGCGGCAGCCACGG + Intronic
1002940473 6:1711197-1711219 TGTGCCCTGGGCTGCAGTCAGGG - Intronic
1003124044 6:3341025-3341047 GGTGGCCTGCTGTGAAGTCAGGG + Intronic
1003181049 6:3792043-3792065 TGTGGCCCACTCTGGAGCCTGGG + Intergenic
1005019097 6:21400804-21400826 TGTGGCTTTATTTGCAGCCAGGG - Intergenic
1006435017 6:34021563-34021585 TGTCCCCTGCCCTGCAGCCCTGG - Intronic
1007605392 6:43114134-43114156 TGGGACCTGCCCTGCAGGCATGG + Intronic
1007693236 6:43716229-43716251 TCTGGCAGGCTCAGCAGCCAAGG - Intergenic
1007709779 6:43815194-43815216 TGTGTCCTGTCCTCCAGCCATGG + Intergenic
1009434043 6:63598086-63598108 TGTTCCCTGTTGTGCAGCCAAGG + Intergenic
1012860300 6:104551507-104551529 TGTGGCCTCCTATGAAACCATGG - Intergenic
1013540048 6:111099339-111099361 TGGGTCCTGCTCTGCTGCCCAGG + Intronic
1015115799 6:129648212-129648234 TGTGGACTGCACTTCAGCCTGGG - Intronic
1015120294 6:129693524-129693546 TGTGGCCCCCACTACAGCCATGG + Intronic
1016933053 6:149428129-149428151 GGTGGCTTCCTCTGCAGCCCAGG - Intergenic
1017395238 6:153991255-153991277 TCTGCCCTGCTCTGTCGCCAAGG + Intergenic
1017488652 6:154925123-154925145 GGTGGCCTGCTCTGTAGCAAGGG + Intronic
1017966063 6:159267337-159267359 TTTGTCCTACTGTGCAGCCATGG + Intronic
1018043518 6:159945897-159945919 TGTGGCCTCACCTGCAGCAAAGG - Intergenic
1018255594 6:161915240-161915262 TGTGCCCTGCACTCCAGCCTGGG + Intronic
1018708846 6:166483271-166483293 TGTGGCCAGCTGCACAGCCATGG - Intronic
1019478455 7:1255243-1255265 TGGGGCCTGCTCTGAGGGCAAGG + Intergenic
1019574152 7:1728200-1728222 TGTGGTCTGCACTGTAGCCCTGG + Intronic
1020248565 7:6449376-6449398 TGTGCCCTCTTCAGCAGCCAGGG + Intronic
1021090764 7:16480046-16480068 TGTGACCTGCCCTGCAGTTATGG + Intronic
1021610876 7:22456901-22456923 GGTGGTCTGCGGTGCAGCCAGGG - Intronic
1022652978 7:32294001-32294023 TGTGGCCCACTCTCCAGCCCTGG - Intronic
1024020810 7:45366759-45366781 TTTGGGCTTCTCTGCAGCCCTGG + Intergenic
1024612133 7:51076055-51076077 TGTGGCTGGCTCTCCTGCCAGGG + Intronic
1024704135 7:51938796-51938818 TCTGGGCTGCTCTGGAGCCTGGG + Intergenic
1025923639 7:65938688-65938710 TGTGGCCTTCAGTGCTGCCAAGG + Intronic
1030344463 7:108416762-108416784 TGTGAACTGCTCTGCAGTGATGG - Intronic
1030346954 7:108444765-108444787 TGTGGCCTTATTTGCAGACAGGG - Intronic
1030351486 7:108493133-108493155 AGTGGCTTGTTCTGCAGCAAAGG + Intronic
1030695784 7:112583268-112583290 TGTGCCCTGCACTCCAGCCTGGG + Intergenic
1031085756 7:117300211-117300233 TGTGTCTTGCTCTGTTGCCAGGG + Intronic
1032187689 7:129741287-129741309 TGTGGTCTCCTCTCCATCCACGG + Intronic
1032515518 7:132503601-132503623 TGTCACATGCTCTGCAGACAGGG + Intronic
1032704299 7:134408799-134408821 CGCAGCCTTCTCTGCAGCCAGGG - Intergenic
1033163948 7:139022500-139022522 TGTGCCCTGCACTCCAGCCTGGG + Intergenic
1035745032 8:1955772-1955794 TGTGGCTGGCTCTGCTGACATGG + Intronic
1036037139 8:5031778-5031800 TGTGCCCTGCACTCCAGCCCAGG + Intergenic
1038255566 8:25947933-25947955 TGTCTTCTGCTCTGCAGCTAGGG - Intronic
1038408517 8:27340719-27340741 TGTGGCCAGGGCTGCAGGCAGGG + Intronic
1038530500 8:28314761-28314783 TGTGGCTTGTTATGCAGCAATGG + Intergenic
1038611218 8:29061598-29061620 AGTGTCCTGCCTTGCAGCCAGGG - Intronic
1038635903 8:29286966-29286988 TGTGGCCTGATTTGAAGACAAGG + Intergenic
1039414189 8:37379481-37379503 TGTGGGAAGCTCTGCAGACAAGG - Intergenic
1039779958 8:40775321-40775343 TCTGACCTGTACTGCAGCCATGG - Intronic
1039904281 8:41774756-41774778 TGTGGCATGCTCTGCGGCGTGGG - Intronic
1040303569 8:46200625-46200647 GGTATCCTGCTCTGAAGCCAGGG - Intergenic
1040484576 8:47857800-47857822 TCTGGGCAGCTCTGCAGACATGG - Intronic
1041595282 8:59643409-59643431 TTTGTCTTGCTCTGCAGCAAGGG - Intergenic
1041830493 8:62147770-62147792 TGTGTCCTGCCCTAGAGCCAGGG + Intergenic
1043086428 8:75840407-75840429 AGAGCCCAGCTCTGCAGCCAGGG - Intergenic
1044317873 8:90770676-90770698 TGTGTCTTGCTGTGCAGCAAGGG - Intronic
1044489269 8:92792749-92792771 GGTGGCTTGCTCTGCAGACCTGG - Intergenic
1046284162 8:112073759-112073781 TGTGTCCTGCCCTGCAACCAGGG + Intergenic
1046659688 8:116936300-116936322 TGTGGTCTGCCATGCAGCAATGG - Intergenic
1046768202 8:118092785-118092807 TTTGGCCTGCCCTTCAGCCTAGG - Intronic
1047766187 8:127991938-127991960 TGTTGCCTGCTGTGCAGCAAAGG + Intergenic
1048317657 8:133374311-133374333 AGTGTCCTGCTCTGCAGGCAGGG + Intergenic
1049263033 8:141649912-141649934 TGTGCCCGGCCCTGCAGCCCTGG + Intergenic
1049355526 8:142186419-142186441 TGCGGACTGCTTTGCAGCCAGGG - Intergenic
1049597459 8:143491351-143491373 TGTGGCCTGCGGTTCCGCCAAGG + Intronic
1049668115 8:143857470-143857492 TTTGGCCAGCACAGCAGCCAGGG + Exonic
1049692171 8:143966214-143966236 AGTGGGCAGCTGTGCAGCCATGG - Intronic
1049841485 8:144775989-144776011 TGTGTTCTGCTGTGCAGACACGG - Intronic
1050668841 9:7973232-7973254 TGTGCCCTGCTTTGAAGCCATGG - Intergenic
1051585396 9:18721676-18721698 TGTGGCCTGCCCTGCTGTCCAGG + Intronic
1053101821 9:35377687-35377709 TGTGGCCTGCTCACCAGTAATGG - Exonic
1054842972 9:69762277-69762299 TGTGCCCTGCACTCCAGCCTGGG + Intergenic
1056177133 9:84045808-84045830 TGTGTCCTGCCCTGCTACCAGGG - Intergenic
1056808718 9:89747802-89747824 CATGGCCTCCTCAGCAGCCATGG + Intergenic
1056833070 9:89932146-89932168 TGTGGCCTGCTCTGGAGCTGGGG + Intergenic
1057414251 9:94847224-94847246 TGTACCCTGCACTGCAGGCATGG - Intronic
1057599169 9:96442216-96442238 TGGGGCCTGCGCTCCAGCAAAGG + Intergenic
1057604243 9:96487924-96487946 TTTGTCCAGCTCTGCAGCCCAGG + Intronic
1057786042 9:98087906-98087928 TGCGGCCTGCTGGGCAGCCTGGG - Exonic
1057790784 9:98123536-98123558 TGCGGACTGCACTGCAGCCTGGG - Exonic
1057831437 9:98410053-98410075 CGTGGCCTGCAGTTCAGCCAGGG + Intronic
1059465993 9:114469245-114469267 TGTGGGCTGCTGTGCAGGCTGGG + Intronic
1060085445 9:120695879-120695901 TCTGGCCTCCCCTGCAGCCAGGG + Intronic
1061022193 9:128023113-128023135 TGTGGCCTCCTGGGCAGCCCTGG - Intergenic
1061086970 9:128405118-128405140 TGTGACCTGGTCTGTGGCCAGGG - Intergenic
1061626018 9:131841144-131841166 TGTGCCCTGCACTCCAGCCTGGG + Intergenic
1061826331 9:133260569-133260591 AGTGGTGTGTTCTGCAGCCATGG + Intronic
1062447317 9:136600391-136600413 TGTGGCCTGTGCTTCTGCCAGGG + Intergenic
1203532558 Un_GL000213v1:160466-160488 GGTGGACGGCTCAGCAGCCAGGG + Intergenic
1185615480 X:1419232-1419254 TGAAGCCCGCTCTGCAGCCCAGG - Intronic
1185762914 X:2701915-2701937 TGTGGTCAACTCTGCAGGCAGGG - Intronic
1185872830 X:3678839-3678861 TGTAGCCTTCTCTGCAGCTAAGG + Intronic
1186637353 X:11420798-11420820 TGTGGAGTGCTCAGCAGCCTTGG - Intronic
1187274161 X:17803983-17804005 GGAGTCCTGCTCTGCAGCCCAGG + Intronic
1190363044 X:49666984-49667006 TGTGGCCAGCTCGGCGGCCCTGG + Intergenic
1190897059 X:54630848-54630870 TGTGCCCTGCACTCCAGCCTGGG - Intergenic
1196012648 X:110904898-110904920 TGTGTCCTGCATTCCAGCCATGG - Intergenic
1196645656 X:118115701-118115723 TCAGGCCTGCTCAGCAGCCAGGG + Intronic
1199967665 X:152833393-152833415 TCTTCCCTGCACTGCAGCCAAGG + Intronic
1200055454 X:153457662-153457684 GGTGGCCTGCTTTCCAGCCAGGG + Intronic
1200142709 X:153909880-153909902 TGTGGCCTGCTTTGCCTACACGG - Exonic
1200791119 Y:7299890-7299912 TGTAGCCTTCTCTGCAGCTAAGG - Intergenic